ID: 1055122549

View in Genome Browser
Species Human (GRCh38)
Location 9:72678989-72679011
Sequence AAATATAGACTTCAGTGGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 254
Summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 230}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055122549 Original CRISPR AAATATAGACTTCAGTGGGA TGG (reversed) Intronic
901329984 1:8399478-8399500 AAATAGAGACGTCAGTGTAATGG - Intronic
902882889 1:19384415-19384437 AAATAAAGAGGACAGTGGGAGGG - Intronic
904870541 1:33615091-33615113 AAATATATATTTCAGGGGGCAGG + Intronic
905309450 1:37038967-37038989 AGGAATTGACTTCAGTGGGAAGG - Intergenic
905819212 1:40976750-40976772 AAATAAAGACAACAGTGGGCTGG - Intergenic
907586591 1:55623365-55623387 AAATCTAATCCTCAGTGGGATGG - Intergenic
909352090 1:74665835-74665857 ACATATAAATTACAGTGGGAGGG + Intronic
911114395 1:94231197-94231219 TAATAGAAACTTCAGTGTGAGGG - Intronic
913180401 1:116315460-116315482 AAAAACAGATTGCAGTGGGAAGG + Intergenic
917576221 1:176324287-176324309 AAATCTAGAGGTCAGTGGAAAGG + Intergenic
919108943 1:193192589-193192611 AAATAGGGACTTCAGTGTAAAGG + Intronic
920904389 1:210148043-210148065 AAATATAGATTTTGGTGGGTTGG - Intronic
924023464 1:239809313-239809335 AAAAATAGACTTCAGAGGCCGGG - Intronic
924285382 1:242481059-242481081 AAATAAAGACTTCTGGGGGTTGG + Intronic
1070468434 10:76749899-76749921 TAGAAAAGACTTCAGTGGGAAGG - Intergenic
1070724650 10:78779833-78779855 AAATACAAACTTCAGTCAGATGG - Intergenic
1073228602 10:101946525-101946547 AAATAAAGAATTCACTGGGTGGG + Intronic
1073527615 10:104199684-104199706 TAAGAAAGACTTCAGTGAGAAGG + Intronic
1078269646 11:9783345-9783367 AAATACAGTCTTCATTTGGAAGG + Intronic
1079260663 11:18876534-18876556 AAACAAAGACTTCATTGGCATGG + Intergenic
1079602965 11:22332492-22332514 AAATATACACTTCAGTATGAAGG - Intergenic
1079951631 11:26812746-26812768 AAATACAGAGTTCAGTTGAAGGG + Intergenic
1080381237 11:31774265-31774287 AATAATAGACTTGAGTGGGAAGG + Intronic
1080603385 11:33842849-33842871 TAATAGAGATTTCAGGGGGACGG - Intergenic
1080839346 11:35969858-35969880 AAATATTTACTTCAGTGACATGG + Intronic
1082173354 11:49032653-49032675 AAATATAGAATGCTGTGCGATGG - Intronic
1084939830 11:72606624-72606646 GGATAAAGAATTCAGTGGGAAGG + Intronic
1085566532 11:77519727-77519749 AAATGTAGATTGCATTGGGAAGG + Intronic
1087953109 11:104249933-104249955 AAATATAGAATTCACGGTGAAGG - Intergenic
1088234619 11:107709196-107709218 AACTATTGTCTTCAGTGAGATGG + Intronic
1090325888 11:125886370-125886392 AAATCCAGGATTCAGTGGGAGGG - Intronic
1090609906 11:128461818-128461840 AAAGATGGACTTCAGTGGGGAGG - Exonic
1090652482 11:128819549-128819571 CAGTCAAGACTTCAGTGGGAGGG + Intergenic
1092021330 12:5204978-5205000 AAATGTAGTTTCCAGTGGGATGG - Intergenic
1092478499 12:8839201-8839223 AAATTTCCCCTTCAGTGGGAAGG + Exonic
1093447263 12:19274664-19274686 AAATATGGATTTCAGAAGGATGG + Exonic
1093816337 12:23553018-23553040 AAAAAGAGACTTCAGTGGAGTGG - Intronic
1097675113 12:62592037-62592059 AGATGTAGACTTGAGTGGGGAGG - Intronic
1097737958 12:63203961-63203983 AAATAAAGACTCAAGTGGGAAGG + Intergenic
1098144485 12:67484832-67484854 AAATATAGTTTTCAGTAGGCAGG + Intergenic
1099741530 12:86641797-86641819 AAATATAGTCCTGATTGGGAAGG + Intronic
1100436875 12:94579185-94579207 AAAAATAATCTTCAGTGAGAGGG - Intronic
1101274092 12:103180106-103180128 AAATGTTGGCTTCATTGGGAAGG - Intergenic
1102099247 12:110265172-110265194 AAAGACAGACTGCAGAGGGAAGG + Intergenic
1102868331 12:116392192-116392214 AAAGACAGACTTCATGGGGATGG + Intergenic
1106872922 13:34041260-34041282 AAGTAGAGACCACAGTGGGATGG + Intergenic
1109643122 13:65218030-65218052 AATTACTGACTTCGGTGGGAAGG + Intergenic
1109665081 13:65523935-65523957 AAAAATAGACTTCACTTGGGAGG + Intergenic
1110241059 13:73267417-73267439 AAATATAGATTACAGAGGGTTGG - Intergenic
1112443997 13:99446852-99446874 AAATACAAACTTCAGGGAGATGG + Intergenic
1112720107 13:102234250-102234272 AAATATACACTTAAATGTGAAGG + Intronic
1112720110 13:102234288-102234310 AAATATACACTTAAATGTGAAGG + Intronic
1112720125 13:102234478-102234500 AAATATACACTTAAATGTGAAGG + Intronic
1112882973 13:104132602-104132624 CACTATAGACTTAAGTGGAAAGG + Intergenic
1112999810 13:105621206-105621228 AAATACACACTTCAATGGAATGG + Intergenic
1115387099 14:32810506-32810528 AAACATAGACTCCCCTGGGAGGG - Intronic
1116661026 14:47710333-47710355 AAATATGGACTTCAATAAGAGGG + Intergenic
1118575290 14:67236236-67236258 AAAAATAGACATGAGTTGGAGGG - Intergenic
1119606722 14:76025090-76025112 AAATATATATACCAGTGGGATGG + Intronic
1124415985 15:29473613-29473635 AAAGATAGACTTCAGTGCTCAGG + Intronic
1126981253 15:54246259-54246281 ACATATAGACTACACTGGGGAGG - Intronic
1127750955 15:62042765-62042787 AAATATAAATTACAGGGGGAAGG + Intronic
1128966984 15:72069297-72069319 AATTGTAGAGTTCAGTGGCAAGG - Intronic
1130998499 15:88919282-88919304 CTTTATAGAGTTCAGTGGGATGG + Intergenic
1131637364 15:94250752-94250774 ACTTATAGAGTTCAGTGTGATGG + Intronic
1133483314 16:6193420-6193442 ATATATAAAATTCAGTGAGAAGG + Intronic
1133497098 16:6329067-6329089 AAAGATTAACTTCAGGGGGAAGG - Intronic
1137235527 16:46613907-46613929 AAATTTACACTTCATTTGGAGGG - Intronic
1138508635 16:57494049-57494071 AAATAAAAACCTCAGTGGGTGGG - Intergenic
1140318095 16:73919233-73919255 ATATATAGACTTGAGGGGAAAGG - Intergenic
1140845744 16:78885797-78885819 ATATATAGACTTAAGTAAGAAGG - Intronic
1140959101 16:79895587-79895609 AATCAGAGACTTCAGGGGGAGGG - Intergenic
1141291139 16:82719031-82719053 AGATATTGACCTCAGTGTGAAGG - Intronic
1143925563 17:10366277-10366299 AGTTATAGAATTAAGTGGGAAGG - Intronic
1146408793 17:32564294-32564316 AATTAGAAACTTCAGAGGGAGGG - Intronic
1147940111 17:44040515-44040537 AAATATAGCCTGAAGTGGGTGGG + Intronic
1153761094 18:8333461-8333483 AATTATAGACTTAAGTGTTATGG + Intronic
1156159248 18:34340498-34340520 AAATATAGATTTAAAAGGGATGG - Intergenic
1156172698 18:34505623-34505645 AAATATAAAAATCAGTGGGTGGG - Intronic
1158177884 18:54678026-54678048 AAATATAGACTGCATTTAGAAGG + Intergenic
1158642107 18:59212769-59212791 AAATACCGATTTCGGTGGGAAGG + Intergenic
1158794530 18:60827497-60827519 AAATAGAGACTTCAGAAAGAGGG + Intergenic
1159509134 18:69373627-69373649 ATATGTAGAGGTCAGTGGGAGGG + Intergenic
1159771550 18:72551572-72551594 ACATATAGACTTCAGTGATGGGG - Intronic
1159837629 18:73358050-73358072 AGATCAAGATTTCAGTGGGAAGG + Intergenic
1160042543 18:75358993-75359015 CAATGAAGACTTCAGTGGCAAGG + Intergenic
925037447 2:700519-700541 AAATATAGAATTCATTGTAATGG + Intergenic
926641450 2:15242149-15242171 AAGCATAGACTTCAGTGTGAGGG - Intronic
927326878 2:21815176-21815198 AAAGATATGCTTCAGTAGGAGGG - Intergenic
930072077 2:47374499-47374521 AAAAAAAGACTTCATTGGAAGGG + Intronic
931280514 2:60787385-60787407 AAATACAGATTTCAGTGGTCTGG - Intronic
933023069 2:77219406-77219428 AAATTCAGACTTCTGGGGGAAGG - Intronic
933831412 2:86212690-86212712 AAAGATGGACTGAAGTGGGATGG + Exonic
935452598 2:103227356-103227378 AAATATAGATATCCATGGGAAGG + Intergenic
937821668 2:126317544-126317566 AAACAATGACTTCAGTGGAAGGG - Intergenic
939152311 2:138487431-138487453 AATTATATCCTTCAGTGGGGAGG - Intergenic
939648244 2:144728890-144728912 AAATAAAGACTTCAAAGGGATGG + Intergenic
939655929 2:144825254-144825276 AACAATAGACTTGGGTGGGAAGG - Intergenic
939828942 2:147049404-147049426 ATATGTTCACTTCAGTGGGAGGG + Intergenic
940056035 2:149513411-149513433 CAATATTAAATTCAGTGGGATGG + Intergenic
941791563 2:169558006-169558028 AAATATAGACTGAAGTGGTTGGG - Intronic
942458660 2:176154577-176154599 AAAAATATATTTAAGTGGGAGGG + Intronic
942552452 2:177133387-177133409 AAAAATAGTGTTCAGTGGGCTGG - Intergenic
943252519 2:185546790-185546812 TTATATAGTTTTCAGTGGGAGGG - Intergenic
945814591 2:214588896-214588918 AAATATAGACAACAGTGTAATGG + Intergenic
946852529 2:223920931-223920953 AAAAACAGACTTCTGAGGGAAGG - Intronic
948617691 2:239211933-239211955 GAATTTAGACTTCAGCGTGAAGG + Intronic
1172202275 20:33134918-33134940 AAAGAAAGACTACAGTGGGAAGG - Intergenic
1172763083 20:37335888-37335910 AAATATAGGGGTCAGTGGGAGGG - Intergenic
1173086788 20:39927412-39927434 AAACATTTATTTCAGTGGGACGG + Intergenic
1174236265 20:49094993-49095015 AAATGGAGACTTTAATGGGAGGG + Intronic
1175000430 20:55622302-55622324 CAAGTTATACTTCAGTGGGAAGG - Intergenic
1178187034 21:30234408-30234430 AAACATAGAGTTCAGAGTGATGG - Intergenic
1178603303 21:34013605-34013627 AAACATAGATTGCAGTGGGCAGG - Intergenic
1179426301 21:41281293-41281315 TAATATAGACTTCAGTAAGTTGG + Intronic
1179614202 21:42571158-42571180 AAGTACAGGCTCCAGTGGGAAGG + Intronic
1182849749 22:33462384-33462406 AAAGATATACTTCAGGAGGAAGG + Intronic
1183134094 22:35870060-35870082 AAATATGGACTTTTGTGGCAAGG + Intronic
1184953833 22:47866457-47866479 AAACATAACCTTCAGTGTGATGG - Intergenic
1185091380 22:48777189-48777211 AAATATAGCCTTCTCTGTGATGG + Intronic
949194927 3:1293694-1293716 AAAAAAAGTCTTCAGTTGGATGG - Intronic
949195816 3:1305765-1305787 AAATATAGTCCTCTGTGTGAAGG - Intronic
951749405 3:26017181-26017203 AAATATAAGCTTGGGTGGGATGG + Intergenic
952465368 3:33579521-33579543 TAAATTACACTTCAGTGGGAAGG - Intronic
952560385 3:34585813-34585835 AAATATAGACATCAGTTTTAAGG - Intergenic
952714156 3:36461974-36461996 AAAAATAGACTTCAATGGCGTGG + Intronic
953963755 3:47286157-47286179 ATAAAAAGCCTTCAGTGGGAAGG + Intronic
954123380 3:48514006-48514028 AAAGTTAGACTGCAGTAGGATGG - Intergenic
956519165 3:70084655-70084677 AAATATAGAATTAATGGGGAGGG - Intergenic
960692861 3:120365312-120365334 AAATATGGACTCCAGTAGGAAGG - Intergenic
962654608 3:137530560-137530582 AACTCTAAATTTCAGTGGGAAGG - Intergenic
963053677 3:141164836-141164858 AAAAAGAAACTTCAGTGGGCTGG - Intergenic
963372740 3:144422351-144422373 AAATATACACTTCAGGAGGCTGG + Intergenic
968016474 3:195338838-195338860 AAATACAGAATTCAGTGGGAAGG - Intronic
970879436 4:20911024-20911046 AAAAATAGACTCCAGTGGAATGG + Intronic
970889623 4:21028267-21028289 GAAAATAGACTACAGTGGGTAGG - Intronic
971002911 4:22342160-22342182 ATATATATACATCAGAGGGAGGG + Intergenic
971256153 4:25015394-25015416 AAAAATAGACTTGAAGGGGAGGG + Intronic
971820921 4:31554020-31554042 AAATATAGATTTGAGGGGTAAGG - Intergenic
972213549 4:36868196-36868218 ACATATAGGCTTCAGGGAGAAGG - Intergenic
974113332 4:57550796-57550818 AAATAAAGAGTACAGTGGGATGG - Intergenic
974927570 4:68319278-68319300 AAATGTAAACTTAAGGGGGAGGG + Intronic
975447211 4:74479942-74479964 AAATATATATTCCAGTGGGAAGG + Intergenic
975834180 4:78404279-78404301 AAATATAGACTTCAGTATAAAGG + Intronic
976100987 4:81563308-81563330 AAAAATAGAATTCATTTGGATGG - Intronic
977398976 4:96507903-96507925 AAATAAAAACTTCAGTGAGCTGG + Intergenic
977414311 4:96712121-96712143 AGACCAAGACTTCAGTGGGAGGG - Intergenic
977989340 4:103421748-103421770 GAATATGGACTTCAGTAGGGAGG + Intergenic
979088387 4:116445069-116445091 AAATATATACTACAGTGGCATGG + Intergenic
979317851 4:119287000-119287022 ACTTATAGACTTAAGTGGGAGGG + Intronic
980918544 4:139058638-139058660 TTATATAGTTTTCAGTGGGAGGG - Exonic
982819496 4:159928168-159928190 AAGACTAGACTTCAGTGGGGAGG + Intergenic
982938292 4:161514445-161514467 AACAATAGACATTAGTGGGAGGG + Intronic
984612549 4:181857305-181857327 AAAGACAGACGTCAGAGGGAAGG + Intergenic
985176268 4:187205753-187205775 AAATATTGAATTGAGTTGGAGGG - Intergenic
986188306 5:5466554-5466576 AAATATAGACTCCAGTATAAGGG - Intronic
989030578 5:37114553-37114575 AAATATAGACTTCAGAATGAAGG - Intronic
989797056 5:45488309-45488331 AAATATAAACTTCAGAAGAATGG + Intronic
989810547 5:45667447-45667469 AATTATAGTTTTCAGTGTGATGG - Intronic
990963324 5:61417661-61417683 AAGTATGCACTTCAGTGGTAAGG - Intronic
991960434 5:72038945-72038967 AAGGATAGACTGCAGGGGGAAGG - Intergenic
992056900 5:72999090-72999112 AGGGATGGACTTCAGTGGGATGG + Intronic
994631591 5:102294879-102294901 AAATATAGATTTTAGAGGGTTGG - Intronic
995315010 5:110759787-110759809 AAAAATAAACTGGAGTGGGAAGG + Intronic
996687625 5:126301390-126301412 AAAAATACATTTCAGTGGGCGGG + Intergenic
996695240 5:126387138-126387160 AAATATGGACTTCAGTCATATGG - Intronic
998027299 5:138829432-138829454 AAAAACAGACTTTGGTGGGAAGG + Intronic
999325495 5:150641060-150641082 CAATCTAGACTTTGGTGGGAAGG - Intronic
999640133 5:153664144-153664166 AAATAGAGAATACAATGGGAGGG + Intronic
999690557 5:154142406-154142428 AAATATTGCCTTCAGTGGATAGG - Intronic
1000343377 5:160294671-160294693 AAGTAAAGAATTCAGTTGGAGGG - Intronic
1001001280 5:168009522-168009544 AAATCGAGACTTCAGTGTGGTGG - Intronic
1001912613 5:175533588-175533610 AAATATAAACTAAATTGGGAAGG + Intergenic
1007932898 6:45708466-45708488 AAACATAGACATAAGTGGGATGG + Intergenic
1008429095 6:51393826-51393848 AAATATTCACATCAATGGGATGG - Intergenic
1009041105 6:58178254-58178276 AGATTTAGACTTCATTTGGAAGG - Intergenic
1009216964 6:60932785-60932807 AGATTTAGACTTCATTTGGAAGG - Intergenic
1009312808 6:62176604-62176626 AAAGATAGCATTCAGTGGCATGG - Intronic
1010385516 6:75275358-75275380 AAATATAGAGTTCAAGGGGAAGG - Intronic
1010705102 6:79099040-79099062 TTATATAGACTTCAGTGACAGGG + Intergenic
1011819757 6:91237497-91237519 AAATAAAGACATCAGTTGGGTGG + Intergenic
1012134052 6:95533720-95533742 AAATAAGGACTTCAGTAGCAAGG - Intergenic
1013443895 6:110201330-110201352 ACATATAGATTTGAGTGAGAGGG + Intronic
1013675118 6:112450895-112450917 AAATAAACACTCCAGTGAGAGGG - Intergenic
1014919312 6:127194211-127194233 AAATATTGAATTCAGTGGTTTGG - Intronic
1015268213 6:131310444-131310466 CAAGATAGACTTCAGAAGGAAGG + Intergenic
1015979187 6:138821764-138821786 GAATATAAACTGCAGTGGGCAGG - Intronic
1016495378 6:144655722-144655744 AAAAATTGTCTTTAGTGGGAAGG + Intronic
1016843537 6:148547910-148547932 AAATGTAGCATTCAGTGGGTAGG - Intronic
1017088633 6:150738299-150738321 AAATCTAAACTTGAGTGGTAAGG - Intronic
1018022025 6:159770507-159770529 AAATTAAGAATTCACTGGGATGG + Intronic
1018313902 6:162537912-162537934 AAATGTAGACTTAAGAGAGAAGG - Intronic
1019486974 7:1293929-1293951 AAATATAATTTACAGTGGGAAGG + Intergenic
1020356688 7:7283880-7283902 AAATATAAAATTCACTGGTAAGG + Intergenic
1023049110 7:36235845-36235867 AAGTGTAGAGTTCAGTGGCATGG + Intronic
1023275333 7:38513079-38513101 TAAAATTGACTTCTGTGGGAGGG - Intronic
1024963399 7:55001938-55001960 AAAAAAAGACATCAATGGGAAGG + Intergenic
1026379878 7:69788406-69788428 AAATAGAGGCTTCAGGGGAAGGG + Intronic
1027530010 7:79318484-79318506 AAATATAGAATTCAAAAGGATGG - Intronic
1028111041 7:86941735-86941757 AAAATTAGACTACAATGGGAAGG + Intronic
1028480759 7:91302148-91302170 AAATATAGACTGAAGTAAGAAGG - Intergenic
1029909488 7:104130313-104130335 ATATAGAGACTACAGTGGAAAGG - Intronic
1030910491 7:115243158-115243180 CAATATAGACTTCAGGGGCAAGG - Intergenic
1032579131 7:133087802-133087824 TTATAAAGACTTCAGTTGGAAGG - Intergenic
1033475777 7:141691087-141691109 AAACATAGCCTTCATTTGGAAGG - Intronic
1034314028 7:150113017-150113039 AAATATAGAGTTCAGTATGCAGG - Intergenic
1034792870 7:153987775-153987797 AAATATAGAGTTCAGTATGCAGG + Intronic
1035299216 7:157886296-157886318 TAATATAGATTTCAGTCGCAGGG - Intronic
1035965173 8:4184076-4184098 AAATGTAGTTTTCAGAGGGAAGG - Intronic
1037157276 8:15718519-15718541 AAATATAGACCTGGCTGGGATGG + Intronic
1038994402 8:32905315-32905337 AAACTTACACTTCAGTGTGAAGG + Intergenic
1039312967 8:36339101-36339123 AAATATAGAATTCTGAGGGGTGG - Intergenic
1041983027 8:63885391-63885413 AAATAAAGAGATCAGTGGAATGG - Intergenic
1042485885 8:69345305-69345327 AATAAGAGAATTCAGTGGGAGGG + Intergenic
1046369088 8:113276609-113276631 AAATAAAAATTTCAGTGGGCTGG - Intronic
1046493964 8:114989412-114989434 ACATTTAGACTTCAGTGGTTAGG + Intergenic
1046892590 8:119439173-119439195 AAAGAAAGGCTTCAGTGAGAGGG + Intergenic
1047333483 8:123914376-123914398 ATATATATACGTCAGTGGGTGGG + Intronic
1047828200 8:128602089-128602111 AAAGGAAGAATTCAGTGGGAAGG + Intergenic
1047952201 8:129944179-129944201 CAATATGGACTACAGTGGTAGGG + Intronic
1048900100 8:139028880-139028902 AAATATAGACTATAGTGGCCGGG - Intergenic
1050152289 9:2628749-2628771 AAAGATAGACTACACAGGGAGGG + Intronic
1050288315 9:4127419-4127441 AGATATAAACTGCAATGGGAGGG - Intronic
1051745158 9:20288465-20288487 AACTATAGAATACAGTGGAAAGG + Intergenic
1052847410 9:33349477-33349499 AAATATGGATTCCAGTGCGATGG + Intronic
1053540106 9:38964940-38964962 AAATAAAAACATCAGTAGGAGGG + Intergenic
1053804456 9:41787097-41787119 AAATAAAAACATCAGTAGGAGGG + Intergenic
1054140828 9:61528365-61528387 AAATAAAAACATCAGTAGGAGGG - Intergenic
1054626034 9:67398981-67399003 AAATAAAAACATCAGTAGGAGGG - Intergenic
1055122549 9:72678989-72679011 AAATATAGACTTCAGTGGGATGG - Intronic
1055369336 9:75580451-75580473 AAATAGAGACATCAGGAGGATGG - Intergenic
1055875551 9:80937662-80937684 ATGTATAGGCTTCAGTGGGCTGG - Intergenic
1056304049 9:85271652-85271674 AAATATAGAATAAAGTGGTATGG - Intergenic
1058326522 9:103705238-103705260 ACATATATACCTCAGTAGGAAGG + Intergenic
1061482121 9:130902539-130902561 AAGCACAAACTTCAGTGGGAGGG + Exonic
1061745149 9:132734049-132734071 AAACATGGACTCCAGTGGGTGGG - Intronic
1185769960 X:2758317-2758339 GAATAAAGACCTCAGTGGGTGGG - Intronic
1185919337 X:4072511-4072533 AAATAAAAATTTCAGTGAGAAGG + Intergenic
1188877275 X:35445373-35445395 ATGTATAGAGTTTAGTGGGAAGG - Intergenic
1189926052 X:45956691-45956713 AAATATAGCATTCACTGGGAGGG - Intergenic
1190729846 X:53218433-53218455 AAAGATAGTGGTCAGTGGGAGGG - Intronic
1192830821 X:74749336-74749358 GAAGATAGACTGGAGTGGGAGGG - Intronic
1193486506 X:82090644-82090666 AAATGCAGACTTCAGAGAGAAGG + Intergenic
1194118276 X:89930134-89930156 AATTATATCCCTCAGTGGGATGG + Intergenic
1194329058 X:92558442-92558464 AAATATGGAGTTCATTGGGAAGG + Intronic
1194440550 X:93928304-93928326 TAATATGGTATTCAGTGGGATGG + Intergenic
1196711055 X:118763206-118763228 AAATATAGACTTCTGTAGGAAGG + Intronic
1197015702 X:121623705-121623727 AAATAAAAACTTCATTGCGATGG - Intergenic
1197433455 X:126395363-126395385 AAATATAAACATTAGTTGGATGG + Intergenic
1199995752 X:153024985-153025007 AAATTTTGACTTGAGAGGGAAGG - Intergenic
1200471155 Y:3587699-3587721 AATTATATCCCTCAGTGGGATGG + Intergenic
1200637763 Y:5677643-5677665 AAATATGGAGTTCATTAGGAAGG + Intronic
1201300562 Y:12501315-12501337 GAATAAAGACCTCAGTGGGTGGG + Intergenic
1201518821 Y:14849580-14849602 AAATTTAGATTTCAGAGGCAGGG - Intergenic