ID: 1055122787

View in Genome Browser
Species Human (GRCh38)
Location 9:72682042-72682064
Sequence GGACTCACCAATCCAAAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 115
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 108}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055122787 Original CRISPR GGACTCACCAATCCAAAAGA GGG (reversed) Intronic
901573470 1:10180920-10180942 GGCCTTACCAAAGCAAAAGAGGG + Exonic
903256681 1:22106993-22107015 GGAGTCAGGAATGCAAAAGAAGG + Intergenic
909158175 1:72108179-72108201 GTACTCATAAATCCATAAGATGG + Intronic
911225560 1:95301350-95301372 GAATTCACCATTCCAAAAGGGGG - Intergenic
912268697 1:108187380-108187402 GGATTAACAAAGCCAAAAGATGG + Intronic
914872166 1:151484206-151484228 GGACTCACAAGTCCAAAGCAAGG - Intergenic
917798518 1:178549764-178549786 GGACTCAATATTCCATAAGACGG - Intergenic
920310582 1:205045969-205045991 TGACTCAGGAATCCATAAGAAGG + Intronic
923284782 1:232483150-232483172 TGACTGACCAATCCAAAACATGG - Intronic
924025711 1:239830868-239830890 GGAACCACCAATCAAAAATATGG - Intronic
924635687 1:245785529-245785551 GGAATCACCCACCCAAAAGGTGG - Intronic
1063417216 10:5883604-5883626 GGGCTCTCTAATCAAAAAGATGG + Intronic
1067552105 10:47243505-47243527 GGACTCAGCAATCCAGATCATGG - Intergenic
1067552374 10:47244954-47244976 GGACTCAACATTCAAAGAGATGG - Intergenic
1072456333 10:95579656-95579678 GGATTCAGCAACCCAAAAAAAGG - Intergenic
1072837822 10:98735641-98735663 GGTCACGCCAATGCAAAAGATGG - Intronic
1078747750 11:14131542-14131564 TGAAGCACCAATCCAAAAGAAGG - Intronic
1083336958 11:61928050-61928072 GGATTCACATATCAAAAAGATGG + Intergenic
1088643591 11:111897512-111897534 GGACTCACCAATTCAGCATATGG - Intergenic
1102934382 12:116884138-116884160 GGAATCACCAATTCACAATAGGG - Intergenic
1105869481 13:24491504-24491526 GGAATCAGTAATCCAAAATAAGG - Intronic
1107229861 13:38096047-38096069 GTACTCACTAATACAAAAGCTGG + Intergenic
1115582799 14:34778095-34778117 GCACTTAGCAACCCAAAAGAAGG + Intronic
1118897342 14:69956041-69956063 GGCCTCACCAAAACAAAAGCTGG - Intronic
1125460340 15:39900685-39900707 TGACCCACCATTCCAGAAGAAGG + Intronic
1129767443 15:78179230-78179252 GCACACCCCACTCCAAAAGAGGG + Intronic
1134871844 16:17659079-17659101 GGAATGACCAAACCAAAAAAGGG + Intergenic
1137816676 16:51404744-51404766 AGACTCACCAGTTCAAATGAAGG + Intergenic
1144410068 17:14992192-14992214 GGACACACTAACCCAAAACATGG - Intergenic
1144527596 17:16003498-16003520 GGACTCTGTAATCAAAAAGATGG + Intronic
1149326111 17:55531283-55531305 GGGTTCACCAAGCCAAAAGGAGG - Intergenic
1149509494 17:57227632-57227654 GAACAAATCAATCCAAAAGAGGG - Intergenic
1156037587 18:32782954-32782976 GGACTCATCAACCCCAAAGTAGG - Intergenic
1163649563 19:18509426-18509448 GGAGTCACCCTTCCGAAAGAAGG + Intronic
1168231933 19:55038195-55038217 GGACTCACCAAGACAGAAGAGGG + Exonic
927828371 2:26326239-26326261 GGACTGGCCACTTCAAAAGACGG + Intronic
928958236 2:36894492-36894514 GGAATCACAAATCCAATTGAAGG + Intronic
929776841 2:44935336-44935358 GGACACACAAAACCAAAAGCCGG + Intergenic
930676373 2:54205107-54205129 GGACTTAGCAATTCAAAGGAGGG - Intronic
937991315 2:127663946-127663968 GGACTCACCCACCCCAAACATGG - Intronic
938049820 2:128158729-128158751 GGACACACAAAGCCAAAAAAGGG - Intronic
938681743 2:133699313-133699335 GCTCTCACCATTCCAGAAGAGGG + Intergenic
940097412 2:149993331-149993353 GGACACACTATTCCAAAATATGG - Intergenic
940124318 2:150307732-150307754 AGCCTCACCAATAAAAAAGAGGG - Intergenic
940521732 2:154759296-154759318 GGACTCTCCAATGCACCAGAAGG + Intronic
943311087 2:186325714-186325736 GGACACACTACTCCAAAACACGG + Intergenic
946451192 2:219781282-219781304 GCATTCAACAATCCAAAATATGG - Intergenic
947154259 2:227145569-227145591 GGTCACACCATTCCAAAGGATGG + Intronic
1169067756 20:2704036-2704058 TGAATCACTAATCCAAAAAAGGG + Intronic
1174372623 20:50102908-50102930 GGACTCACAAATACAAAGGCGGG - Intronic
1174933183 20:54838300-54838322 GGACTCAAAAATTCAAATGAAGG + Intergenic
1175460029 20:59145669-59145691 AGAGCCACCAAACCAAAAGAGGG - Intergenic
1177385787 21:20407964-20407986 GGACTGAGCCTTCCAAAAGAAGG + Intergenic
1181801435 22:25350449-25350471 GGACCCAGCCATCCAAAAGGAGG - Intergenic
1182139995 22:27945906-27945928 GGACTAAACACTCCAAAAGGCGG - Intergenic
1183481746 22:38069108-38069130 GGACTCACCATTGCACAGGATGG - Exonic
964480695 3:157135694-157135716 GCACTCATGAATTCAAAAGATGG + Intergenic
964902375 3:161675309-161675331 GGACAGACCAACCCAAAACATGG + Intergenic
969201254 4:5608128-5608150 GGACTCTTCCATCCAACAGAAGG - Intronic
974385139 4:61194837-61194859 GCACTCTGCAGTCCAAAAGAGGG - Intergenic
977464013 4:97360069-97360091 AAACTCACCAATACAAAACAAGG - Intronic
978333754 4:107644185-107644207 GGACACACTACTCCAAAATATGG + Intronic
981016352 4:139978283-139978305 AGGCTCACCACTCCCAAAGATGG - Intronic
984100362 4:175477114-175477136 GGACTGACCACTGCAAAACATGG - Intergenic
984938103 4:184907418-184907440 GAACTTACCTATCCACAAGATGG - Intergenic
985026585 4:185744907-185744929 TGAGCCCCCAATCCAAAAGAAGG - Intronic
986377556 5:7148139-7148161 AGCCTCCCCAAGCCAAAAGATGG + Intergenic
987965690 5:24869223-24869245 TGAGTCACCATTCCAAAAAAGGG - Intergenic
989296553 5:39834288-39834310 GGATATACCAATACAAAAGAGGG - Intergenic
989834134 5:45963035-45963057 AAACTCATCAATCCAAAAAAAGG - Intergenic
990382759 5:55232777-55232799 GGGCTCAGCAATTCAAAGGAAGG + Intronic
995462082 5:112414250-112414272 CAACTCACCATTCCAAAAGAGGG + Intronic
995987909 5:118202591-118202613 GGACTCACCAACTCACAACAAGG + Intergenic
998725860 5:145013927-145013949 TGACTGACCTATCCCAAAGATGG + Intergenic
999731382 5:154478563-154478585 AGAATCACCAAGCGAAAAGAAGG + Intergenic
1004423567 6:15492569-15492591 GGACCCACCAATCTAACAAAAGG - Intronic
1005601176 6:27427782-27427804 GGTGTCACCTAACCAAAAGAGGG + Intergenic
1010275503 6:73964251-73964273 GGACTCAACACACTAAAAGAAGG - Intergenic
1014019759 6:116573643-116573665 GGAATCATAAATACAAAAGAAGG - Intronic
1015693268 6:135950751-135950773 GGACTCGCCAATGGAAGAGAAGG - Intronic
1015825935 6:137312048-137312070 GGACTCACTATCCCAAAATATGG + Intergenic
1015845463 6:137515733-137515755 GGACTTACCACCCCAAAATATGG + Intergenic
1019111568 6:169721061-169721083 GGACCCAGCCATCCAAAAGGAGG - Exonic
1020587554 7:10088135-10088157 GGACACACTGTTCCAAAAGATGG + Intergenic
1026676195 7:72430645-72430667 GCACTGACCAATCAAAATGAAGG + Intronic
1027933878 7:84577049-84577071 GGACTCACAAATAAAATAGAAGG + Intergenic
1028669035 7:93379795-93379817 GAAGTTACCAATCCAAATGATGG - Intergenic
1033819059 7:145111351-145111373 GGACTCTCCTATTCAAAAAATGG - Intergenic
1034372323 7:150610204-150610226 GGAAACACAAAACCAAAAGAGGG + Intergenic
1034744154 7:153507502-153507524 GGTCTCACAAAACCAAAATAGGG - Intergenic
1038374884 8:27029939-27029961 GGTCTCTCCTATCCTAAAGATGG + Intergenic
1040837364 8:51746527-51746549 AGACTCACCAATGCCAAAAATGG - Intronic
1040970057 8:53126021-53126043 TGACTAACCTATCCAAAAGTTGG - Intergenic
1043364060 8:79510812-79510834 GGACTAAGCAATCCAAAAGAGGG + Intergenic
1047433385 8:124813403-124813425 ATACTCAATAATCCAAAAGAAGG + Intergenic
1047969742 8:130074587-130074609 GGAAACAGCAATGCAAAAGATGG + Intronic
1050460078 9:5870032-5870054 GGACTCACCAACCTGAAAGCAGG - Intergenic
1052954783 9:34245269-34245291 GAAAACACCAAACCAAAAGAGGG - Intronic
1052958501 9:34273909-34273931 GAAAACACCAAACCAAAAGAGGG + Intronic
1053283785 9:36837955-36837977 GTACACATCATTCCAAAAGAAGG + Exonic
1055122787 9:72682042-72682064 GGACTCACCAATCCAAAAGAGGG - Intronic
1057590855 9:96372261-96372283 GAACTGAACAATCCAAAATATGG + Intronic
1186843709 X:13510226-13510248 TGACTTACCAATCCCAAAGCTGG + Intergenic
1187088219 X:16064758-16064780 GGACATACCACTCCAAAATATGG + Intergenic
1187315632 X:18191681-18191703 GCACTCAGCAATAAAAAAGAAGG + Intronic
1187671441 X:21669748-21669770 GAACTCACCCATCAAAAAGTGGG + Intergenic
1189276355 X:39788982-39789004 GGACCCACTACTCCAAAATATGG - Intergenic
1189960818 X:46323387-46323409 GGACACACTACTCCAAAAGATGG - Intergenic
1192982937 X:76366674-76366696 GGTCACAATAATCCAAAAGATGG + Intergenic
1195490483 X:105463149-105463171 GGACTCACCCATTCCATAGAAGG - Intronic
1198131982 X:133704799-133704821 GGACACACCACCCCAAAATATGG - Intronic
1198786426 X:140293304-140293326 GGACACACAAACCCAAAATATGG - Intergenic
1199581896 X:149368781-149368803 GGTCTCTCCAGTCCACAAGAAGG - Intergenic
1199595448 X:149503198-149503220 GGACTCGCCCAGCCAGAAGAGGG + Intronic
1199598430 X:149526013-149526035 GGACTCGCCCAGCCAGAAGAGGG - Intronic