ID: 1055123613

View in Genome Browser
Species Human (GRCh38)
Location 9:72692388-72692410
Sequence AGATGAACACAAAATCAGCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 615
Summary {0: 1, 1: 0, 2: 1, 3: 34, 4: 579}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055123613_1055123618 22 Left 1055123613 9:72692388-72692410 CCTAGCTGATTTTGTGTTCATCT 0: 1
1: 0
2: 1
3: 34
4: 579
Right 1055123618 9:72692433-72692455 AGTTTCCGAATTTCTCACGAAGG No data
1055123613_1055123619 23 Left 1055123613 9:72692388-72692410 CCTAGCTGATTTTGTGTTCATCT 0: 1
1: 0
2: 1
3: 34
4: 579
Right 1055123619 9:72692434-72692456 GTTTCCGAATTTCTCACGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055123613 Original CRISPR AGATGAACACAAAATCAGCT AGG (reversed) Intronic
901588095 1:10315336-10315358 ACAAAAACACAAAATTAGCTGGG - Intronic
902034935 1:13450835-13450857 AAAAAAACACAAAATTAGCTGGG - Intergenic
902201142 1:14834520-14834542 AAATATACAGAAAATCAGCTGGG - Intronic
902338339 1:15766752-15766774 CGAAAAACACAAAATTAGCTGGG - Intronic
902593433 1:17491475-17491497 AAAAGAACTAAAAATCAGCTGGG - Intergenic
902671616 1:17978488-17978510 TGAAAAACACAAAATTAGCTAGG + Intergenic
903537606 1:24077276-24077298 AGATGTACACATCATCAGATTGG - Intronic
903600233 1:24532789-24532811 ATATGAAAACAAAATTAGCCGGG + Intronic
903898541 1:26624966-26624988 AAATAAAAATAAAATCAGCTGGG + Intergenic
904192833 1:28760739-28760761 CCATAAATACAAAATCAGCTGGG - Intronic
904302779 1:29566104-29566126 AGAACAAAACAAAATCAGGTGGG - Intergenic
904384353 1:30131789-30131811 AGATAAACCCAACATCAGGTAGG + Intergenic
904827523 1:33283538-33283560 AGAAAAATACAAAATTAGCTGGG + Intronic
905614568 1:39386419-39386441 AAAAGAAAAAAAAATCAGCTGGG - Intronic
905716812 1:40159489-40159511 AAATGAAAACAAAATTAGCCAGG - Intergenic
906226640 1:44128240-44128262 AAAGAAAAACAAAATCAGCTAGG - Intronic
906342232 1:44990537-44990559 CTATAAATACAAAATCAGCTGGG - Intergenic
906457353 1:46008489-46008511 AGAAGAACAGAAAGTCAGCCAGG + Intronic
906899378 1:49816921-49816943 AGCTGCTCACAAAATCAGATTGG + Intronic
907664196 1:56419701-56419723 AGAAATACACAAAATTAGCTGGG - Intergenic
907963133 1:59301872-59301894 AGAAAAATACAAAATCAGCTGGG - Intronic
908144011 1:61218561-61218583 AGAAGAAAATAAAATCACCTTGG + Intronic
908422660 1:63974304-63974326 ATATTAAAACAAATTCAGCTAGG + Intronic
908426160 1:64009504-64009526 AAATGATCACAAAGTAAGCTGGG - Intronic
908994393 1:70134002-70134024 AGATGCACACATATTCAGATTGG - Intronic
909445660 1:75745327-75745349 AAATAAACAAAAAATTAGCTAGG + Intronic
909771473 1:79427591-79427613 AGAAGAACAAAACATCAGTTAGG + Intergenic
910350420 1:86290557-86290579 AGATGAATAGATAAACAGCTGGG - Intergenic
910457924 1:87417689-87417711 AAATGTACAAAAAATTAGCTGGG + Intergenic
911108655 1:94160288-94160310 GGATGAATGCAAAATTAGCTGGG - Intronic
911814498 1:102328401-102328423 AGAAAAAAACAAAATTAGCTGGG + Intergenic
911992114 1:104711971-104711993 AGATGAACAGAAAATCAGGCCGG - Intergenic
912326438 1:108767742-108767764 AAATGAAGAAAAAATTAGCTGGG - Intronic
912706181 1:111915590-111915612 AGAAATACAAAAAATCAGCTGGG + Intronic
913519818 1:119634147-119634169 ATATGATCACAGAATCATCTGGG - Intronic
914728844 1:150352502-150352524 AGAAATACAAAAAATCAGCTGGG + Intronic
915006459 1:152642219-152642241 AAAAGAACAAAAAATTAGCTAGG + Intergenic
915939574 1:160110270-160110292 ACATGCACACAAAATTAGCTGGG - Intergenic
916007805 1:160677954-160677976 AGCTAAACACAAAAGTAGCTGGG + Intergenic
916126759 1:161578238-161578260 AGATAGACACAGAATCAGGTAGG - Intergenic
916136678 1:161660078-161660100 AGATAGACACAGAATCAGGTAGG - Intronic
916811987 1:168313759-168313781 TCATGCACACAAAATTAGCTGGG + Exonic
917186287 1:172360223-172360245 AGATGAACCCCAAATCAATTTGG + Intronic
917387624 1:174494228-174494250 ACATCAACACAAAAGCAGCATGG - Intronic
919711908 1:200737554-200737576 AAATACACAAAAAATCAGCTGGG + Intergenic
919950563 1:202359484-202359506 AAATTAAAAAAAAATCAGCTGGG + Intronic
920863674 1:209733238-209733260 AGAAGAACACAACATCATTTTGG + Intronic
920983573 1:210862494-210862516 ACAACAACACAAAATCAGCTTGG - Intronic
921624771 1:217367216-217367238 AAATAAAAACAAAATTAGCTGGG - Intergenic
921687289 1:218104566-218104588 AGCTGGACTCAAAATCAGTTGGG + Intergenic
921711314 1:218376467-218376489 AGATGAATAAAAAATGAGATAGG + Intronic
922325117 1:224521149-224521171 AGATGGACAGAAAATCGACTTGG - Intronic
922525594 1:226300558-226300580 AAATAAACAAAAAATCTGCTGGG + Intronic
923637785 1:235718325-235718347 AGATAAATACAAAAACATCTGGG - Intronic
924071459 1:240284602-240284624 AGACAAACACAAACTTAGCTAGG + Intronic
924548343 1:245051229-245051251 AGAAAAAAAAAAAATCAGCTGGG + Intronic
924806252 1:247364154-247364176 AAAAGTACAAAAAATCAGCTGGG + Intergenic
1063025363 10:2173246-2173268 CGTTGAACATAAAATCATCTTGG + Intergenic
1064055359 10:12092640-12092662 ATAAAAACACAAAATTAGCTGGG + Intronic
1064759506 10:18603628-18603650 ACACACACACAAAATCAGCTGGG - Intronic
1065308550 10:24391890-24391912 TCAGGAAAACAAAATCAGCTAGG - Intronic
1065433551 10:25683994-25684016 AGAGAAGCACAAAATGAGCTTGG - Intergenic
1065655900 10:27949616-27949638 AGATGAGCTGAAAACCAGCTGGG + Intronic
1066252351 10:33646782-33646804 AAATGCACAAAAAATTAGCTGGG + Intergenic
1066527524 10:36297262-36297284 AGAAGAACCAAAAATCAGGTGGG - Intergenic
1066714379 10:38270861-38270883 AGAAGAAAAAAAAATTAGCTGGG - Intergenic
1067518551 10:46976108-46976130 AAATGAATAAAAAATTAGCTGGG - Intronic
1067643697 10:48075720-48075742 AAATGAATAAAAAATTAGCTGGG + Intergenic
1067714658 10:48681318-48681340 AAAAGCACAAAAAATCAGCTGGG + Intergenic
1067728061 10:48788186-48788208 AAAAGTACAAAAAATCAGCTGGG - Intronic
1067897609 10:50201014-50201036 AGATGAACAGAAAAGCAGAATGG + Intronic
1068159093 10:53240788-53240810 AGATTAACACACTATCATCTAGG + Intergenic
1068383042 10:56283570-56283592 ACATCAACCAAAAATCAGCTTGG + Intergenic
1069413338 10:68174974-68174996 AGAAGCACAAAAAATTAGCTGGG + Intronic
1069656680 10:70094914-70094936 AGAAGAACACAAAATCTGTGGGG - Intronic
1069840105 10:71334450-71334472 ATATGAAGACAAATTCAGCAGGG - Intronic
1071093623 10:81948471-81948493 TGATGATCTCCAAATCAGCTGGG - Intronic
1071914068 10:90270905-90270927 AAGTAAACACAAAAGCAGCTTGG - Intergenic
1072157760 10:92739281-92739303 AAATAAACAAAAAATTAGCTGGG + Intergenic
1072328114 10:94318592-94318614 GGATGGACACAATTTCAGCTTGG - Intronic
1072634356 10:97168053-97168075 ACATGAATACAGAATGAGCTGGG + Intronic
1073766876 10:106692200-106692222 AAAAGAACCCAAAATTAGCTGGG - Intronic
1073906008 10:108280595-108280617 AGTTGATCACAAAATCAGGATGG + Intergenic
1073957819 10:108892808-108892830 AAATGACCACAAAATGAGCCTGG + Intergenic
1075417102 10:122272275-122272297 AGATGAAGACACCAGCAGCTGGG + Intronic
1075448869 10:122533491-122533513 AAATATACAAAAAATCAGCTGGG - Intergenic
1075555732 10:123430487-123430509 AGCTGAACACAAGCGCAGCTTGG + Intergenic
1078109182 11:8378355-8378377 ATAAAAACACAAAATTAGCTGGG + Intergenic
1079794591 11:24784576-24784598 AAATGAAAACAAAAACAGATTGG - Intronic
1080521264 11:33069764-33069786 AGATATACAAAAAATTAGCTGGG - Intronic
1081521933 11:43890232-43890254 AGAAGAATACAAAGTCAGCAAGG - Intronic
1081816137 11:45943602-45943624 AGATGTATGCAAAATCAACTTGG - Intronic
1083210811 11:61184410-61184432 AAATATACAAAAAATCAGCTGGG + Intergenic
1083251393 11:61470154-61470176 TGGTGAACAAAAAATTAGCTGGG - Intronic
1083442455 11:62686150-62686172 AAAAAAATACAAAATCAGCTGGG + Intergenic
1083464641 11:62837169-62837191 AGATGAACACTATATTAGGTTGG - Intronic
1083702395 11:64488116-64488138 ATACAAAAACAAAATCAGCTGGG - Intergenic
1084103161 11:66963441-66963463 AAAAAAATACAAAATCAGCTGGG + Intergenic
1084199922 11:67549599-67549621 AGTTGGAAAAAAAATCAGCTGGG - Intergenic
1084985616 11:72868528-72868550 AGTTGAAAAAAAAATTAGCTAGG + Intronic
1085111594 11:73894661-73894683 AAATAAAAAAAAAATCAGCTGGG + Intronic
1086011082 11:82104293-82104315 ATATGAAAACAAAATGAGATAGG - Intergenic
1087051175 11:93887866-93887888 ATACAAAAACAAAATCAGCTGGG - Intergenic
1087569841 11:99911986-99912008 AGGTGAAGACAAAATAAGCATGG - Intronic
1087709750 11:101534865-101534887 AAATGAACACAAACTGGGCTGGG + Intronic
1088198519 11:107304000-107304022 AGAGAAAAACAAAATCAGCCAGG + Intergenic
1088666570 11:112099565-112099587 ATATGAAAACAAAATTAGCCGGG - Intronic
1088904800 11:114146686-114146708 AAATTAAAAAAAAATCAGCTGGG + Intronic
1089201852 11:116729472-116729494 AGAAGACCACAGAATAAGCTGGG - Intergenic
1089426169 11:118377366-118377388 AAAAAAATACAAAATCAGCTGGG - Intronic
1089955011 11:122562262-122562284 CCAAAAACACAAAATCAGCTGGG - Intergenic
1090367112 11:126215846-126215868 AGAAAATCACAAAATTAGCTGGG + Intronic
1090442293 11:126734500-126734522 CGAAAAATACAAAATCAGCTGGG + Intronic
1090737726 11:129625613-129625635 ACATGAACACAAAATCCTTTGGG + Intergenic
1091087977 11:132741866-132741888 AAAAAAACACAAAATTAGCTGGG + Intronic
1091521327 12:1246966-1246988 AAAGGAACAGAAAATTAGCTGGG + Intronic
1091617121 12:2057943-2057965 AAAAGAACACAAAAACAACTGGG + Intronic
1092182088 12:6452928-6452950 AGAGGGACACAGAAACAGCTAGG + Intronic
1092259058 12:6942681-6942703 ATCTTAAGACAAAATCAGCTGGG + Intergenic
1093750494 12:22793412-22793434 AAATAAAAACAAAATTAGCTGGG + Intergenic
1094096476 12:26710786-26710808 AGATGAACCCAAAGCTAGCTAGG + Intronic
1094248680 12:28333460-28333482 AAATGACCACAAAAGCACCTAGG + Intronic
1094674815 12:32609452-32609474 AGAGGAAGACAAAATAAGATGGG - Intronic
1095051878 12:37561867-37561889 AAAAGTACAAAAAATCAGCTGGG + Intergenic
1096158247 12:49354376-49354398 AAACAAACACAAAATTAGCTAGG + Intronic
1096299767 12:50416521-50416543 ACAAAAACACAACATCAGCTGGG + Intronic
1096413723 12:51394866-51394888 AAATGAAAATAAAATTAGCTGGG + Intronic
1098074118 12:66708577-66708599 AGATGACCACAAAATTAGTCTGG - Intronic
1098631646 12:72730229-72730251 AGCTTAACCAAAAATCAGCTGGG - Intergenic
1098799540 12:74936524-74936546 AGCTGAATACAAAATTAGCTGGG - Intergenic
1099427686 12:82544784-82544806 ACAAGAATACAAAATTAGCTGGG - Intergenic
1101283629 12:103286088-103286110 ACAAAAACAAAAAATCAGCTGGG + Intronic
1101307529 12:103544052-103544074 ATATAAAAACAAAATTAGCTGGG - Intergenic
1101340669 12:103840248-103840270 AGGTGCACATAAAATGAGCTTGG - Intronic
1101556060 12:105810796-105810818 AGATGAAGACAATATCTTCTAGG + Intergenic
1102078027 12:110075318-110075340 ATATAAAAACAAAATTAGCTGGG - Intergenic
1102084923 12:110128634-110128656 ACAACAACAAAAAATCAGCTGGG + Intronic
1103441242 12:120964573-120964595 AGAAGAAAAGAAAATCAGCAGGG - Intergenic
1103443014 12:120977670-120977692 ACACACACACAAAATCAGCTGGG + Intergenic
1103553895 12:121754382-121754404 AGATGAACACAGAAGCAGGTAGG - Intronic
1103569869 12:121837914-121837936 AAATAAAAACAAAATTAGCTGGG + Intergenic
1103594360 12:122014865-122014887 AAATGAAAAAAAAATCAGCCAGG - Intergenic
1103834871 12:123810530-123810552 ACATACACACAAAATTAGCTGGG + Intronic
1105736199 13:23274170-23274192 AAATGAATACTAAATGAGCTGGG - Intronic
1106311654 13:28560016-28560038 GGATGAACACAATATGGGCTGGG - Intergenic
1107121840 13:36804596-36804618 AAATCAACAAAAAATAAGCTGGG - Intergenic
1107228720 13:38083071-38083093 AGATGAACCCAAAAGCAGAATGG + Intergenic
1107538105 13:41356138-41356160 ACACGCACACAAAATCAGCTAGG - Intronic
1107847621 13:44533299-44533321 AGAAGTACAAAAAATTAGCTGGG + Intronic
1108342390 13:49510624-49510646 AGATAAATAAAAAATTAGCTGGG - Intronic
1109111990 13:58332437-58332459 ATATGAAAAAAAAATTAGCTGGG + Intergenic
1109639197 13:65164884-65164906 ATACAAAAACAAAATCAGCTGGG + Intergenic
1110108941 13:71718425-71718447 AAATTAAAACAAAATTAGCTGGG + Intronic
1110536067 13:76652208-76652230 AAATAAATACAAAATTAGCTGGG - Intergenic
1112788237 13:102975094-102975116 AGATAAAGAGAAAATCAGCCAGG - Intergenic
1112957453 13:105078372-105078394 AGATGAAAATAAAATTAGGTAGG - Intergenic
1113014030 13:105807141-105807163 AGATAAACAGGAGATCAGCTGGG + Intergenic
1113146325 13:107212087-107212109 AGATGAACCTAAAATCAGCATGG + Intronic
1113231408 13:108217356-108217378 AGAAAAATACAAAATTAGCTGGG + Intronic
1114187039 14:20410581-20410603 AAAAGAAAAAAAAATCAGCTGGG - Intronic
1114321442 14:21550090-21550112 ATAAAAACACAAAATTAGCTGGG - Intergenic
1115031838 14:28805129-28805151 AAATGAACACAAAGTCAGAAAGG - Intronic
1115175509 14:30558071-30558093 AAATGTACAAAAAATTAGCTGGG - Intergenic
1115376416 14:32681837-32681859 AAAAGTACAAAAAATCAGCTGGG - Intronic
1115431556 14:33325114-33325136 GAATGAACACCAGATCAGCTTGG + Intronic
1115594641 14:34897620-34897642 ATAAAAACACAAAATTAGCTGGG + Intergenic
1117153308 14:52911488-52911510 AAATAAACAAAAAATTAGCTGGG + Intronic
1117642645 14:57816449-57816471 TGATGAACCCCAAATCAGGTAGG - Intronic
1117710206 14:58520681-58520703 AAATGAAAACAAAATTAGCCGGG - Intronic
1117977026 14:61309120-61309142 AGAAAAATACAAAATTAGCTGGG + Intronic
1117980049 14:61333961-61333983 AGAGGACCAAAAAATCTGCTGGG - Intronic
1119265192 14:73260149-73260171 AGAGGAACCCAAAATCAGAGAGG - Intronic
1119760580 14:77148136-77148158 AATTGAAAAAAAAATCAGCTGGG - Intronic
1120162449 14:81160720-81160742 AGATACAAACAAAATTAGCTGGG + Intergenic
1120342345 14:83237401-83237423 AAATAAAAAAAAAATCAGCTGGG + Intergenic
1120982098 14:90299205-90299227 AAAAAAACACAAAATTAGCTGGG - Intronic
1121501647 14:94442825-94442847 AGATGAAGACAGCATCAGTTTGG + Intronic
1122442730 14:101743718-101743740 ATGAGAACACAAAATCATCTAGG + Intergenic
1122495271 14:102149324-102149346 TGATAAATACAAAATCAGCCGGG - Intronic
1122500229 14:102192966-102192988 AGAAAAATAAAAAATCAGCTAGG - Intronic
1122676511 14:103419129-103419151 ATACGAAAACAAAATTAGCTGGG + Intronic
1123702710 15:22927753-22927775 AGATGTACTTAAAATCACCTTGG + Intronic
1124107340 15:26752422-26752444 AAATAAACAAAAAATTAGCTGGG - Intronic
1125568674 15:40697259-40697281 AGAAAAATACAAAATTAGCTGGG - Intronic
1125691550 15:41600150-41600172 AAATGTACAAAAAATTAGCTGGG + Intergenic
1126107595 15:45156876-45156898 ACAGGGACACAGAATCAGCTCGG - Intronic
1126301222 15:47198532-47198554 AGGTGAAAACAATAACAGCTTGG + Intronic
1126432771 15:48603951-48603973 ATATGAACACAAAATTAATTTGG - Intronic
1126951276 15:53884486-53884508 AAATAAACAAAAAATTAGCTGGG - Intergenic
1127139980 15:55965360-55965382 AAAAGTACAAAAAATCAGCTGGG - Intronic
1127918826 15:63477053-63477075 AGAAATACAAAAAATCAGCTGGG + Intergenic
1128106139 15:65046307-65046329 AAATAAATACAAAATTAGCTGGG + Intronic
1128171257 15:65515651-65515673 AGATGAAAATAAAATCAGGTAGG - Exonic
1128549809 15:68590861-68590883 AGAGGAACACAGAATAAGCTTGG - Intronic
1128844448 15:70877970-70877992 ATATGAAAACAAAATTAGCCGGG + Intronic
1129062838 15:72874004-72874026 AGATGAAGACAAAAGCTGTTGGG - Intergenic
1129292122 15:74576495-74576517 AAATGAAAACAAAATTAGCCAGG + Intronic
1129350188 15:74951534-74951556 TGATGAATACAAAATTAGCCGGG - Intergenic
1130512691 15:84602304-84602326 GGATAAACACAAAATCAGCAGGG - Intronic
1130786015 15:87097488-87097510 AGAAAAATACAAAATTAGCTGGG - Intergenic
1132531442 16:452172-452194 AAACAAACAAAAAATCAGCTGGG + Intronic
1133181962 16:4062938-4062960 AGTTAAACAGAAAATCAGCAAGG + Intronic
1134593951 16:15480412-15480434 AAATGAAAATAAAATCAGATTGG - Intronic
1135045149 16:19149293-19149315 AAATTAAAACAAAATTAGCTAGG + Intronic
1135129856 16:19844399-19844421 AGTTGAACCCAATTTCAGCTGGG + Intronic
1135391486 16:22097124-22097146 AAAAATACACAAAATCAGCTGGG - Intronic
1135473765 16:22755450-22755472 AGATGAACACAAGGACATCTGGG - Intergenic
1135496258 16:22954105-22954127 AGATGAACACAACCTCATGTTGG + Intergenic
1135519439 16:23163058-23163080 AAATAAACAAAAAATCAGCCGGG + Intergenic
1135636457 16:24079674-24079696 AAGAGAACACAAAATCAGCTTGG - Intronic
1135862012 16:26064776-26064798 AGAAAAATACAAAATCAGCCCGG - Intronic
1136751056 16:32636178-32636200 AGATAAAAAAAAAATTAGCTGGG + Intergenic
1138040504 16:53659727-53659749 AAATTAAAACAAAATTAGCTGGG + Intronic
1138137053 16:54532269-54532291 TGATCTACACAAAAACAGCTGGG + Intergenic
1138160367 16:54747549-54747571 AGAAAAATACAAAATTAGCTGGG + Intergenic
1138310550 16:56019947-56019969 AGATGAACTTGAAATCAACTGGG + Intergenic
1139394418 16:66629165-66629187 ATTTGTACACAGAATCAGCTGGG + Intronic
1139569451 16:67801797-67801819 AGTTAAAAAAAAAATCAGCTGGG + Intronic
1140646781 16:77039366-77039388 ATAAGAACAAAAAATCAGGTGGG - Intergenic
1140764937 16:78148735-78148757 AAAATAACACAAAATTAGCTGGG + Intronic
1140849433 16:78921051-78921073 AGATAAGCACAAAATCTGGTTGG - Intronic
1140985283 16:80152810-80152832 AAATAAAAAAAAAATCAGCTGGG + Intergenic
1141105004 16:81226315-81226337 AGTAGAACAAAAAATGAGCTGGG - Intergenic
1203053190 16_KI270728v1_random:895434-895456 AGATAAAAAAAAAATTAGCTGGG + Intergenic
1203139346 16_KI270728v1_random:1749986-1750008 AAAAGAACACAAAATTAGTTAGG + Intergenic
1142706272 17:1696682-1696704 AAATGTACAAAAAATTAGCTGGG + Intergenic
1143267218 17:5648090-5648112 AGAAAAACACAAAATGGGCTGGG - Intergenic
1143790302 17:9289617-9289639 AAAAAAACAAAAAATCAGCTGGG + Intronic
1143856138 17:9850988-9851010 AAGTGAAAAAAAAATCAGCTGGG - Intronic
1145078527 17:19875300-19875322 AGACAAAAAAAAAATCAGCTGGG - Intergenic
1145137117 17:20419302-20419324 AGAAAAAAAAAAAATCAGCTGGG - Intergenic
1145210552 17:21009980-21010002 AAAAAATCACAAAATCAGCTGGG + Intronic
1146321112 17:31847272-31847294 AGAGAAAAAAAAAATCAGCTGGG - Intergenic
1146423994 17:32718538-32718560 AAATGAAAAAAAAATTAGCTGGG + Intronic
1146748955 17:35359841-35359863 AGATGAACATAAAATCATGAGGG + Intronic
1148290757 17:46446596-46446618 AAAAGAATACAAAATCAGCCAGG + Intergenic
1148312947 17:46664301-46664323 AAAAGAATACAAAATCAGCCAGG + Intronic
1148500262 17:48084747-48084769 AAATGTACAAAAAATTAGCTGGG + Intronic
1148506251 17:48129605-48129627 AGTTGAAAACAAAATCAACCCGG + Intergenic
1148816513 17:50331865-50331887 AAAAGAAAACAAAATTAGCTGGG - Intergenic
1149070021 17:52529696-52529718 AGATTAACAGAAAATAGGCTGGG - Intergenic
1149147582 17:53515050-53515072 AGATGACCAGAAAATAAGTTAGG - Intergenic
1150259781 17:63779557-63779579 AGAAGAAAACAAAATGAGGTGGG - Intronic
1150398367 17:64837949-64837971 AGAAGAAGAAAAAATTAGCTGGG - Intergenic
1150638841 17:66935693-66935715 AAATAAAAACAAAATTAGCTGGG - Intergenic
1150892606 17:69170819-69170841 AAGTAAACACAAAATCTGCTTGG + Intronic
1150923527 17:69508210-69508232 AGAAAAAAAAAAAATCAGCTGGG - Intronic
1151888693 17:76939351-76939373 AAACAAACAAAAAATCAGCTGGG + Intronic
1152486491 17:80597669-80597691 AAATAAACAAAAAATTAGCTGGG - Intronic
1153944764 18:10009036-10009058 AGCTAAACACAAAAGCACCTTGG - Intergenic
1153972015 18:10235621-10235643 AGCTGAACCCAAGACCAGCTTGG - Intergenic
1154219528 18:12440160-12440182 AGATGCACAGAATATCGGCTTGG - Intergenic
1154263613 18:12860126-12860148 AAATATACAAAAAATCAGCTAGG + Intronic
1154983149 18:21521212-21521234 AAATAAATACAAAATCAGCCGGG + Intronic
1156037450 18:32781866-32781888 TGACAAACACTAAATCAGCTAGG - Intergenic
1156427699 18:37032800-37032822 ATAAAAACACAAAATTAGCTGGG - Intronic
1157256984 18:46148342-46148364 AGATAAAAGCAAAATTAGCTGGG - Intergenic
1157380384 18:47209574-47209596 GGATGGAAACAAAATCAGCATGG + Intergenic
1157790565 18:50527632-50527654 ATATGAACACAGAGTGAGCTAGG + Intergenic
1157808400 18:50675475-50675497 AAATAAAAACAAAATTAGCTGGG - Intronic
1157945714 18:51978180-51978202 AGATGAACACAACCTCAACTAGG + Intergenic
1157963640 18:52183906-52183928 AAATAAATACAAAATTAGCTGGG - Intergenic
1158025139 18:52886758-52886780 AGAAGAACCAAAAATCAGGTGGG - Intronic
1158506439 18:58050307-58050329 AAATGAAAAAAAAATCAGCTGGG + Intronic
1158607187 18:58906089-58906111 TGATGAACACAACCTCAGCCAGG - Intronic
1159502139 18:69286964-69286986 TGATAAATACAAAATCAGGTAGG + Intergenic
1160254409 18:77235618-77235640 AGCTGAGAACACAATCAGCTGGG - Intergenic
1160434661 18:78838144-78838166 AAACCCACACAAAATCAGCTGGG + Intergenic
1161286841 19:3472683-3472705 AAATAAACATAAAATTAGCTGGG + Intergenic
1161558745 19:4958812-4958834 AAATTAAAACAAAATTAGCTGGG + Intronic
1161577346 19:5061705-5061727 AAAAGAAGAAAAAATCAGCTGGG + Intronic
1161841118 19:6681086-6681108 ACAAGAACAAAAATTCAGCTGGG + Intronic
1162037012 19:7946110-7946132 CTAAGAACACAAAATTAGCTGGG - Intergenic
1162131960 19:8531507-8531529 ACATCACCACAAAATTAGCTGGG - Intronic
1162210448 19:9087436-9087458 AAATGTTCAAAAAATCAGCTGGG - Intergenic
1162358148 19:10200120-10200142 AAATAAACAAAAAATTAGCTGGG - Intronic
1162749290 19:12818680-12818702 AGAGAAAAACAAAATTAGCTGGG - Intronic
1163066159 19:14797338-14797360 ATACAAAAACAAAATCAGCTGGG + Intronic
1163104461 19:15115497-15115519 AGAGGAACACAAGCCCAGCTGGG + Intronic
1165640753 19:37383910-37383932 AAATGAAAAGAAAATCAGATTGG - Intronic
1166826493 19:45613056-45613078 AAATACACACAAAATTAGCTGGG - Intronic
1167424457 19:49422994-49423016 AAATGGACAGAAAATCAGCAAGG - Intronic
1167580845 19:50341583-50341605 AAATGAAAAAAAAATTAGCTAGG - Intronic
1168657373 19:58140571-58140593 AAATGTACAAAAAATCAGCTGGG - Intronic
925518732 2:4716084-4716106 AGAGGAACATAAAAGCAGCAGGG + Intergenic
925850966 2:8081704-8081726 AAAAAAATACAAAATCAGCTGGG + Intergenic
927629154 2:24756091-24756113 AAAAGAATACAAAATTAGCTGGG + Intronic
927668277 2:25047219-25047241 AGGTGAACACAAAACCAGAGCGG - Intronic
928298369 2:30105044-30105066 CTAAAAACACAAAATCAGCTGGG - Intergenic
928831072 2:35483432-35483454 AGAAAAATACAAAATGAGCTAGG - Intergenic
929628611 2:43435296-43435318 AGAAGAATACAAAATTAGCCAGG + Intronic
931334619 2:61326942-61326964 AAATAAAAAAAAAATCAGCTGGG - Intronic
932974693 2:76585021-76585043 CTAAAAACACAAAATCAGCTGGG - Intergenic
933481128 2:82858423-82858445 CCAAAAACACAAAATCAGCTAGG - Intergenic
933498002 2:83075735-83075757 AGATGGACACAAATGCAGATAGG - Intergenic
933569303 2:83990765-83990787 AGATAATCACAAAAGGAGCTTGG - Intergenic
933904289 2:86874519-86874541 ATATAAAAACAAAATTAGCTGGG - Intergenic
935837422 2:107070222-107070244 AGAGGAACACAAATTCATTTTGG + Intergenic
936956050 2:118023348-118023370 AGAAGTACAAAAAATCAGCCAGG + Intergenic
937027471 2:118711365-118711387 AGAGGGAGACAAAAGCAGCTTGG - Intergenic
937058723 2:118965246-118965268 TGAAAAACAGAAAATCAGCTGGG - Intronic
937496740 2:122428573-122428595 AGAGGAAGAAAAAACCAGCTGGG - Intergenic
937788752 2:125934406-125934428 ACATACACACAAAATTAGCTGGG + Intergenic
937892773 2:126951991-126952013 ATATGAAAACAAAATTAGCCAGG - Intergenic
938787320 2:134642958-134642980 AGATGAACAAAGAATAAGCATGG + Intronic
939082482 2:137679434-137679456 AAAAGTACAAAAAATCAGCTGGG + Intergenic
939399102 2:141668472-141668494 AGAGGAACAGAAAGTCAGCGTGG + Intronic
940231374 2:151456891-151456913 AAATACACAAAAAATCAGCTGGG - Intronic
940569921 2:155418062-155418084 ATAAAAACACAAAATTAGCTGGG - Intergenic
940853549 2:158710949-158710971 AGCTAAACAGAAAATCAGCAAGG - Intergenic
940860192 2:158763220-158763242 AAATAAACAAAAAATTAGCTGGG + Intergenic
941473531 2:165920250-165920272 AAATGAACAGAAAATCATTTAGG - Intronic
941538971 2:166758770-166758792 ACATTAAAAAAAAATCAGCTGGG + Intergenic
941591005 2:167420393-167420415 AGATGAACTAAAAATAACCTGGG + Intergenic
942330396 2:174817620-174817642 AAAAGAAAAAAAAATCAGCTGGG - Intronic
943329235 2:186539040-186539062 TGAAGAACACAATACCAGCTGGG - Intergenic
943661753 2:190566457-190566479 AGAAGTACAAAAAATTAGCTGGG + Intergenic
944334377 2:198513630-198513652 AGAAAAAAAAAAAATCAGCTGGG - Intronic
945049775 2:205812498-205812520 AGAAGAAAATAAAAGCAGCTGGG + Intergenic
945949438 2:216024720-216024742 AAAAGAAAAAAAAATCAGCTGGG + Intronic
946713037 2:222525757-222525779 AGATAAACACACAATGAGCAAGG - Intronic
946894150 2:224305953-224305975 ATAAAAATACAAAATCAGCTGGG + Intergenic
947956297 2:234195174-234195196 AGACAAACACAAAACCAGCATGG + Intergenic
1168756020 20:318316-318338 ATAAGAACACAAAATTAGCCAGG + Intergenic
1169760474 20:9086818-9086840 TCAAGAACACATAATCAGCTAGG - Intronic
1170093950 20:12624068-12624090 AGACTAACACACAAACAGCTGGG + Intergenic
1170493309 20:16900022-16900044 AGATGTACATAAAATGAGATGGG + Intergenic
1170832121 20:19851560-19851582 ACAAAAACAAAAAATCAGCTGGG + Intergenic
1172151556 20:32794196-32794218 AGAGAAATACAAAATTAGCTGGG + Intronic
1172417201 20:34779351-34779373 AAATAAACAGAAAATTAGCTGGG + Intronic
1172452518 20:35037184-35037206 AGAAGTACAAAAAATTAGCTGGG + Intronic
1173069245 20:39745485-39745507 ATATGAAAACAAAATCCACTAGG - Intergenic
1173538562 20:43834117-43834139 AGATGATATCAAAAGCAGCTAGG + Intergenic
1174473049 20:50775044-50775066 AAATGTACAAAAAATTAGCTGGG - Intergenic
1174836461 20:53860207-53860229 AAAAGAACACAAAATTAGTTAGG + Intergenic
1174884499 20:54317618-54317640 AGATGAGCACACATTCATCTTGG + Intergenic
1176889079 21:14292649-14292671 AGATGAACAGAAAATCTACAAGG + Intergenic
1177049520 21:16214835-16214857 AAAAAAATACAAAATCAGCTCGG - Intergenic
1177841476 21:26238923-26238945 AGAGCAAAACAAAATCAGCTTGG + Intergenic
1178269250 21:31174806-31174828 AAAAGTACACAAAATTAGCTGGG - Intronic
1178569451 21:33721892-33721914 AGAAGAAGAAAAAATTAGCTGGG - Intronic
1180894031 22:19314801-19314823 AGATGCAAAAAAAATTAGCTGGG + Intergenic
1180918007 22:19503004-19503026 AAATAAAAAAAAAATCAGCTGGG + Intronic
1181004117 22:20001644-20001666 AGATACAAACAAAATTAGCTGGG + Intronic
1181293430 22:21815848-21815870 AGATAAAAAAAAAATTAGCTGGG + Intronic
1181678663 22:24475497-24475519 AGAAAAACACAAAATTAGCTGGG - Intergenic
1181747516 22:24966182-24966204 CTATCAACACAAAGTCAGCTGGG - Intronic
1182196146 22:28520595-28520617 AAATAAACAAAAAATCAGCCAGG + Intronic
1182229714 22:28828422-28828444 ATAAAAACACAAAATTAGCTGGG - Intergenic
1183811331 22:40260305-40260327 AGAAAATCACAAACTCAGCTTGG - Intronic
1184379998 22:44139361-44139383 AGAAAAATACAAAATTAGCTGGG - Intronic
1184436861 22:44484464-44484486 AAATGAAAAGAAAACCAGCTGGG - Intergenic
1184980355 22:48091162-48091184 AGATGAACATTAGTTCAGCTTGG - Intergenic
1185200125 22:49496944-49496966 CCAAAAACACAAAATCAGCTGGG + Intronic
949863310 3:8526084-8526106 TGATTAGCACAAAATCACCTGGG - Intronic
950239887 3:11359533-11359555 AGAAAAACAAAAAATTAGCTAGG + Intronic
950481044 3:13243947-13243969 AGATGGCCACAAAAGCAGTTAGG + Intergenic
951937440 3:28037288-28037310 AGATGAGCCCAAACTGAGCTAGG - Intergenic
952260997 3:31740202-31740224 AAAAGAATACAAAATTAGCTGGG - Intronic
952321737 3:32284090-32284112 AAAAGTACAAAAAATCAGCTGGG + Intronic
952515709 3:34103072-34103094 ATAAGAACAAAAAATCAGGTAGG - Intergenic
952662349 3:35866874-35866896 AGATGATCACAGTGTCAGCTGGG + Intergenic
954033799 3:47839453-47839475 CTAAAAACACAAAATCAGCTGGG - Intronic
954664611 3:52245356-52245378 AGATGGGGACAAAATGAGCTGGG - Intergenic
954805038 3:53213790-53213812 AGGGGAACAAAAAATCAGATGGG + Intergenic
955645429 3:61132416-61132438 AGATGAGCACAACATAATCTTGG + Intronic
955938967 3:64129873-64129895 AGATAAAGCCAAAATGAGCTGGG - Intronic
956161163 3:66354324-66354346 AAATGAAAATAAAATCAGTTTGG + Intronic
956236854 3:67082201-67082223 AGATGGAAACATAATCAGATAGG - Intergenic
956827978 3:73016669-73016691 AAATAAACACAAAAACATCTAGG - Intronic
957147417 3:76442241-76442263 AGATGAACACAATATATCCTCGG - Intronic
957225850 3:77444971-77444993 ATGAGAACACCAAATCAGCTTGG - Intronic
959249687 3:103926246-103926268 ACAACAACAAAAAATCAGCTGGG + Intergenic
959255550 3:104007414-104007436 ATACAAAAACAAAATCAGCTGGG - Intergenic
959713858 3:109411545-109411567 AAATAAAAACAAAATTAGCTGGG + Intergenic
960129464 3:114039347-114039369 AGAGGAAAAAAAAATTAGCTGGG + Intronic
960665744 3:120107221-120107243 AGATGTACAAAATATCAGCATGG - Intergenic
961162816 3:124744032-124744054 AGATGTACAGAAAAGCTGCTTGG + Exonic
961833715 3:129639394-129639416 ATATGAAAACAAAATTAGCCGGG + Intergenic
961972653 3:130986797-130986819 ACATGAACACAAAATGAAGTAGG - Intronic
962549263 3:136472523-136472545 CTATGAACAGAAAATAAGCTGGG + Intronic
962784389 3:138753223-138753245 AAATAAAAACAAAAACAGCTGGG + Intronic
963099993 3:141592108-141592130 AGATGAACAAAAAAGAAGCAGGG + Intronic
963454019 3:145521355-145521377 ATAAAAACACAAAATTAGCTGGG - Intergenic
964241945 3:154604581-154604603 AGATGAACATAAAATAATCGGGG - Intergenic
964362239 3:155910406-155910428 AGAAATACAAAAAATCAGCTGGG + Intronic
965987280 3:174770677-174770699 AAATGTACAAAAAATTAGCTGGG + Intronic
966774601 3:183532926-183532948 AGATGAACCCATAAAGAGCTGGG + Intronic
966863875 3:184245590-184245612 AGATGTACACGAAACCAGCTGGG + Exonic
967021070 3:185523561-185523583 AAATAAAAACAAAATTAGCTGGG - Intronic
967278017 3:187795493-187795515 AAAAGAGAACAAAATCAGCTAGG + Intergenic
967752891 3:193134619-193134641 ATATCAAAACAAAAGCAGCTGGG + Intergenic
968141200 3:196258748-196258770 ACAAGAATAAAAAATCAGCTGGG - Intronic
968347055 3:198017513-198017535 ATATTAACACCAAATGAGCTAGG - Intronic
969188897 4:5501163-5501185 AGATGAAATCAAACTTAGCTTGG + Intergenic
969857613 4:10013056-10013078 AGATGAACACCACAGTAGCTAGG - Intronic
970291605 4:14578909-14578931 AGATGAGCACGAGATCAGCATGG + Intergenic
970642000 4:18076971-18076993 ATATGAAAAAAAAATTAGCTGGG - Intergenic
971809711 4:31408897-31408919 AAAGGCACACAAAATCAACTAGG + Intergenic
971876323 4:32313597-32313619 AGATAAACACAGAATCAGGTGGG - Intergenic
972648566 4:40993543-40993565 AAATAAACAAAAAATTAGCTGGG - Intronic
973749501 4:53999455-53999477 AGATGTGCATAAAATCAGCTGGG - Intronic
974438122 4:61882953-61882975 ACATGCACACAAAATTAGCTGGG + Intronic
974860183 4:67510974-67510996 AGATGAATACATAAACAGATGGG - Intronic
975213977 4:71732815-71732837 AAATTAATACAAAATCATCTGGG - Intergenic
975318467 4:72982079-72982101 AAAACAACACAAAATCAGCGGGG + Intergenic
975981564 4:80166291-80166313 AGAAAAACACAAAATTAGCTGGG - Intergenic
976212231 4:82682807-82682829 AGAAAAACAAAAAATTAGCTGGG - Intronic
976913305 4:90336603-90336625 AGAAGAACTACAAATCAGCTTGG + Intronic
976970827 4:91100187-91100209 AGATAAAAAAAAAATCAGTTTGG + Intronic
978430049 4:108624093-108624115 TGCTGAACACAAAATCAGATGGG + Intronic
978718157 4:111871230-111871252 ATCTCAACAGAAAATCAGCTGGG + Intergenic
979116402 4:116829782-116829804 AAAAGAAAAGAAAATCAGCTGGG - Intergenic
979223104 4:118252387-118252409 AGTTGAACACAAAATGAGAAGGG - Intronic
979922018 4:126509647-126509669 AGATGATCAAAAACTCAGCAGGG + Intergenic
980115414 4:128674216-128674238 AAATAAACAAAAAATTAGCTGGG - Intergenic
981131906 4:141166436-141166458 GGATGAACATAAAATGAGTTAGG - Intronic
981259414 4:142701968-142701990 AGTTCAACACAAAATGAACTAGG + Intronic
981352368 4:143746866-143746888 AAATGAAAAAAAAATCAGCTAGG - Intergenic
981583682 4:146275997-146276019 AGCTGGACACAAAATGAGGTAGG + Intronic
981719505 4:147787365-147787387 ACATGAACACAACATCAGCAGGG + Intronic
981849297 4:149209773-149209795 ACATGAACACAAAATGAAGTCGG - Intergenic
982249705 4:153392260-153392282 ATATAAAAACAAAATTAGCTGGG - Intronic
982304572 4:153916739-153916761 AAATGACCAAAAAATAAGCTGGG - Intergenic
982372017 4:154644086-154644108 AAAAGTACACAAAATTAGCTGGG - Intronic
982704303 4:158690516-158690538 AAAAGAAAACAAAATTAGCTGGG + Intronic
983844647 4:172502738-172502760 AGAAGAACACAACATCATGTGGG + Intronic
984141020 4:176003799-176003821 AAATAAACAAAAAATTAGCTTGG + Intergenic
986179100 5:5376700-5376722 AGATGGACACAAAACCAGCTGGG + Intergenic
986411451 5:7484752-7484774 AAAGGAAAACAAAAACAGCTGGG - Intronic
988295582 5:29356369-29356391 AGAAGAACACAAAATTTGCAGGG + Intergenic
988491521 5:31709325-31709347 AGAAAAGCAAAAAATCAGCTGGG + Intronic
988575168 5:32415922-32415944 AACTGAACAAAAAATGAGCTTGG - Intronic
988894549 5:35657754-35657776 ATATGACCACAAAACCAGGTGGG - Intronic
989311993 5:40030364-40030386 GGCTGAACATAAAATCATCTGGG - Intergenic
989431019 5:41355574-41355596 AGAGGACCTCAATATCAGCTAGG + Intronic
989468034 5:41781062-41781084 AAAAAAATACAAAATCAGCTGGG - Intronic
989498754 5:42140858-42140880 CGAAAAACACAAAATTAGCTGGG + Intergenic
989609577 5:43278204-43278226 TTAAAAACACAAAATCAGCTAGG - Intronic
989769755 5:45129835-45129857 AAAAAAACACAAAATTAGCTGGG - Intergenic
991071424 5:62486139-62486161 AAATAAACAAAAAATTAGCTGGG - Intronic
992121160 5:73594192-73594214 AAATAAACAAAAAATTAGCTGGG + Intergenic
992273574 5:75091142-75091164 ACATGAATACAAAACTAGCTTGG + Intronic
993043335 5:82839852-82839874 AGATGAACAGAAACTCAACTGGG + Intergenic
993603874 5:89962951-89962973 ATATGAAAACAAACTCTGCTAGG + Intergenic
994199501 5:96956575-96956597 AGAAATACTCAAAATCAGCTAGG - Intronic
994367519 5:98932401-98932423 AAAAGTACACAAAATTAGCTGGG - Intergenic
994580976 5:101641427-101641449 ACATGCACAAAAAATTAGCTAGG + Intergenic
994814504 5:104568252-104568274 AAAAGTACAAAAAATCAGCTGGG + Intergenic
994945209 5:106379029-106379051 GGATTAACACAAAATCACATGGG + Intergenic
995130804 5:108628510-108628532 AAAAGAACACAGAGTCAGCTAGG + Intergenic
995846956 5:116503668-116503690 AAAAGAAAAAAAAATCAGCTGGG - Intronic
996507888 5:124288341-124288363 AAAAAAACACAAAATTAGCTGGG - Intergenic
996619184 5:125479454-125479476 AGCTGAGCATAAAATCTGCTTGG - Intergenic
996688820 5:126315198-126315220 TTCTGAACACAAAATGAGCTTGG - Intergenic
996827704 5:127703879-127703901 AGATGCACACACAAAAAGCTGGG + Intergenic
996837517 5:127810314-127810336 AGATGACCCCAAAATGACCTTGG - Intergenic
996924188 5:128803843-128803865 AAATGAAAACAAAATTAGATGGG + Intronic
997167436 5:131676171-131676193 AGAAGTACAAAAAATTAGCTGGG - Intronic
997308104 5:132855598-132855620 ACAACAACAAAAAATCAGCTGGG - Intergenic
997308870 5:132862987-132863009 ACAAAAACAAAAAATCAGCTGGG - Intronic
997467766 5:134099738-134099760 AAATAAAAACAAAATTAGCTGGG - Intergenic
997798431 5:136834831-136834853 TGATGGAAACAAAATCAGATAGG + Intergenic
997970453 5:138397172-138397194 ATACAAAAACAAAATCAGCTGGG + Intronic
998083490 5:139295982-139296004 AGACGATCAAAAAATTAGCTTGG - Intronic
998123432 5:139598719-139598741 AAAAAAACACAAAATTAGCTGGG - Intronic
998197814 5:140090899-140090921 AGAAGAACACAAGATCAGAGAGG + Intergenic
998575240 5:143308315-143308337 AAATTAAAAAAAAATCAGCTGGG + Intronic
998620585 5:143790139-143790161 ACAAAAACACAAAATTAGCTGGG - Intergenic
998632298 5:143912600-143912622 AAAAGAAAACAAAAGCAGCTAGG + Intergenic
999614914 5:153413023-153413045 AAATGAAAATAAAATTAGCTGGG + Intergenic
999709651 5:154306117-154306139 AGATAGACAGAAAATCAGCAAGG + Intronic
999709687 5:154306826-154306848 AGATAGACAGAAAATCAGCAAGG + Intronic
999885325 5:155916588-155916610 AAAGAAACACAAAATCAGGTTGG - Intronic
999902493 5:156099878-156099900 ATATTAACATAAAAACAGCTGGG - Intronic
999909484 5:156182289-156182311 AGCAGAACAGAAAATAAGCTGGG + Intronic
1000799285 5:165704626-165704648 AAAATAACACAAAATTAGCTGGG - Intergenic
1002145690 5:177179374-177179396 CTAAAAACACAAAATCAGCTGGG - Intronic
1002498271 5:179630748-179630770 AAAAGTACAAAAAATCAGCTGGG + Intronic
1003612214 6:7623810-7623832 AGCTGACCAAAAAATCAGGTTGG + Intergenic
1003826016 6:9953067-9953089 AAATAAAAACAAAATTAGCTGGG - Intronic
1004644164 6:17543458-17543480 ATACGAAAACAAAATTAGCTGGG + Intronic
1004783365 6:18937696-18937718 AGATGATAACAATATCAGCAAGG - Intergenic
1005210814 6:23460165-23460187 AGTTCAACACATAAACAGCTTGG + Intergenic
1005299822 6:24459412-24459434 AAAGTAACAAAAAATCAGCTGGG - Intronic
1006359759 6:33580600-33580622 AGATGAACAGAGGCTCAGCTGGG + Intergenic
1006765177 6:36498746-36498768 AGAAAAATAAAAAATCAGCTGGG - Intronic
1007921564 6:45614871-45614893 AGATTAAAACAAAATCTGCTGGG + Intronic
1008334164 6:50280209-50280231 ACATGAACACAAAAACACATAGG + Intergenic
1009791549 6:68407788-68407810 AGATAAACTCATAAACAGCTAGG + Intergenic
1010309876 6:74372859-74372881 AGAGGAAAACAAAAACACCTGGG + Intergenic
1010429433 6:75762090-75762112 ATACAAACACAAAATTAGCTGGG - Intronic
1010804945 6:80224551-80224573 AGAAAAATACAAAATTAGCTGGG - Intronic
1011739000 6:90340644-90340666 AGATGAACACAATATCCTATTGG + Intergenic
1012613978 6:101252545-101252567 AGAAGTACAAAAAATTAGCTGGG - Intergenic
1013470191 6:110457329-110457351 AGAAGAATACAAAATAAGCCTGG + Intronic
1013608213 6:111770584-111770606 ATAAGAACACAAAATAAACTAGG - Intronic
1014298616 6:119652170-119652192 ATAAAAACACAACATCAGCTGGG - Intergenic
1015273862 6:131364759-131364781 AGAAGAACACATGCTCAGCTGGG + Intergenic
1016967903 6:149735810-149735832 ACAACAACAAAAAATCAGCTAGG + Intronic
1017283104 6:152644478-152644500 AAATAAAAACAAAATCAGCCAGG - Intergenic
1017513373 6:155133876-155133898 CTAAAAACACAAAATCAGCTGGG - Intronic
1017553358 6:155535696-155535718 AGGTGAATATAAAATAAGCTTGG - Intergenic
1018224865 6:161618923-161618945 AGATGAATGCGAAGTCAGCTTGG - Intronic
1018632942 6:165835967-165835989 AGAAGAAGACAAGTTCAGCTGGG - Intronic
1019235128 6:170605522-170605544 AGAAGTACAAAAAATTAGCTGGG - Intergenic
1019824715 7:3274581-3274603 AGATGAACACAAAAGGTGATAGG + Intergenic
1020015825 7:4831028-4831050 AAAAAAATACAAAATCAGCTGGG + Intronic
1020242288 7:6405021-6405043 AAATACACACAAAATTAGCTGGG - Intergenic
1020383217 7:7568047-7568069 GAATGAACACAGAATCAGCATGG + Exonic
1021489020 7:21198085-21198107 AAATATACAAAAAATCAGCTGGG + Intergenic
1021599516 7:22351026-22351048 AGATGAGAACAAAGTAAGCTGGG + Intronic
1021732755 7:23612302-23612324 ATACAAACAAAAAATCAGCTGGG + Intronic
1021846486 7:24768076-24768098 TGCTGACCACAAAACCAGCTGGG - Intergenic
1022978949 7:35585129-35585151 AGAAGAACAGAAAGTCACCTTGG + Intergenic
1023312276 7:38900088-38900110 AAATGAAAAGAAAATTAGCTAGG + Intronic
1023943714 7:44786808-44786830 AGAAGTACAAAAAATTAGCTGGG + Intergenic
1024242811 7:47448359-47448381 AGAGGAACATCAAACCAGCTGGG - Intronic
1024303964 7:47910815-47910837 ACACACACACAAAATCAGCTGGG - Intronic
1024424545 7:49210872-49210894 AAATAAAGACAAAAGCAGCTGGG + Intergenic
1024728003 7:52221361-52221383 TAATGAACAGAAAATCAGCAAGG + Intergenic
1025783594 7:64623477-64623499 ATATAAAAACAAAATAAGCTGGG + Intergenic
1026355257 7:69551896-69551918 ATATAAAAACAAAATAAGCTGGG + Intergenic
1027726479 7:81812068-81812090 TGATAAGCACAAAATCAGCATGG + Intergenic
1027809976 7:82883928-82883950 AAAAGTACACAAAATTAGCTGGG - Intronic
1027890786 7:83971269-83971291 AGAAAAATACAAAATTAGCTGGG + Intronic
1028250380 7:88533140-88533162 ACAAGAGAACAAAATCAGCTAGG - Intergenic
1028598857 7:92578886-92578908 AGATAAAAAAAAAATTAGCTGGG + Intronic
1029816310 7:103099308-103099330 CTAAGAACACAAAATTAGCTGGG + Exonic
1029997019 7:105015681-105015703 AGATTACCACAACATCAGCCTGG - Intronic
1030010683 7:105163648-105163670 AAATAAATACAAAATTAGCTGGG + Intronic
1030075174 7:105730569-105730591 AAATGTACAAAAAATTAGCTGGG + Intronic
1030838901 7:114322810-114322832 ATATAAACACAAAATCAATTTGG - Intronic
1031712191 7:125062772-125062794 AGATGAAGCCAAAACCAGTTTGG + Intergenic
1031953854 7:127922149-127922171 AGAAAAAAAGAAAATCAGCTGGG - Intronic
1032735681 7:134690819-134690841 AGCTGAGCCCAGAATCAGCTGGG - Intergenic
1032899921 7:136295597-136295619 AAATAGACAAAAAATCAGCTGGG - Intergenic
1033182514 7:139194847-139194869 TGATGAACACCAAGTCAGCATGG + Intergenic
1033285149 7:140035068-140035090 AAATGAAAACAAAATTAGTTGGG - Intronic
1034627217 7:152503001-152503023 AGAAAAAAAAAAAATCAGCTAGG + Intergenic
1035550798 8:523430-523452 ATAAGAACTAAAAATCAGCTTGG + Intronic
1035789186 8:2288449-2288471 AGACGAACACAAGATCAGAAAGG - Intergenic
1035803619 8:2433256-2433278 AGACGAACACAAGATCAGAAAGG + Intergenic
1036196238 8:6717742-6717764 ATATGAACACAAATTAAGCCCGG - Intronic
1036553370 8:9835072-9835094 AAATGAACAAAACATAAGCTTGG + Intergenic
1036904958 8:12700279-12700301 AGATGAAAACAAAAGCACTTCGG - Intergenic
1037177468 8:15963835-15963857 ATATGAAAACAAAATTAGCAGGG + Intergenic
1038684066 8:29699444-29699466 AGATAAACACAAAGTCACCCTGG + Intergenic
1038841192 8:31186309-31186331 AAATAAAAAAAAAATCAGCTGGG + Intergenic
1040586422 8:48747325-48747347 AGATGAAAACAAAAACGACTAGG - Intergenic
1040688114 8:49901131-49901153 AGATGAAAACACGATTAGCTAGG + Intergenic
1040698831 8:50036533-50036555 AGATGAACAAGAAAACAGCTGGG - Intronic
1041154627 8:54972681-54972703 AAAAGAAGACAAAATTAGCTGGG - Intergenic
1041859092 8:62490994-62491016 AGATGATCAGAAAATGAGCAAGG - Intronic
1041995928 8:64057964-64057986 ACACAAACACACAATCAGCTAGG - Intergenic
1042160093 8:65884359-65884381 AAATAAAAATAAAATCAGCTGGG - Intergenic
1042191467 8:66191777-66191799 AGATGAACACAAAATTATCAAGG - Intergenic
1043088709 8:75870950-75870972 AGATAAAGACAAAAACATCTAGG + Intergenic
1043874940 8:85475209-85475231 ACAAAAACACAAAATTAGCTGGG + Intronic
1043878864 8:85518208-85518230 AGAAGTACAAAAAATTAGCTGGG + Intergenic
1044427142 8:92064990-92065012 AGATGCACACACATTCAGCTAGG - Intronic
1045012551 8:97970788-97970810 AGAATAAAAAAAAATCAGCTGGG + Intronic
1045837701 8:106542371-106542393 AGATGAACAAAAATCCATCTAGG - Intronic
1046017353 8:108621072-108621094 AAATCAAAACAAATTCAGCTGGG - Intronic
1046725504 8:117669401-117669423 AGATGAGCAGAAAAACAACTTGG + Intergenic
1047156140 8:122320762-122320784 AGATAAACAGAAAATTAGCCAGG - Intergenic
1047278429 8:123424041-123424063 ATAAAAACACAAAATCAGCCGGG - Intronic
1048189973 8:132279056-132279078 AAATAAAAAAAAAATCAGCTGGG + Intronic
1049036039 8:140076868-140076890 ACATAACCACAAAATCAGCTGGG + Intronic
1053085893 9:35221227-35221249 AAAAATACACAAAATCAGCTGGG - Intronic
1054777455 9:69135599-69135621 AGAAAAAAAAAAAATCAGCTAGG - Intronic
1055123613 9:72692388-72692410 AGATGAACACAAAATCAGCTAGG - Intronic
1055178127 9:73346534-73346556 AGAAGTACACAAAAAGAGCTAGG - Intergenic
1055793429 9:79948347-79948369 AAATGAACATAAAAGCAGGTTGG - Intergenic
1055797510 9:79990983-79991005 AGAAGCAAACAAAATCAGCTCGG - Intergenic
1056139733 9:83664256-83664278 AAATAAAAACAAAATTAGCTGGG + Intronic
1056528090 9:87462662-87462684 AAATAAACAAAAAATTAGCTGGG - Intergenic
1057055350 9:91956320-91956342 TGATTCACCCAAAATCAGCTGGG + Intergenic
1057590510 9:96369127-96369149 AGATGGACACAAATGCAGCAAGG + Intronic
1057834293 9:98431854-98431876 AAATAAATACAAAATTAGCTGGG - Intronic
1058126082 9:101196702-101196724 ATATAAAAACAAAATTAGCTGGG + Intronic
1058469398 9:105261746-105261768 AGAGAAACACAGATTCAGCTGGG - Intronic
1059503143 9:114773390-114773412 AAAAGTACAAAAAATCAGCTGGG - Intergenic
1059674671 9:116526459-116526481 AGAACAACAAAAAATTAGCTAGG + Intronic
1059878315 9:118660858-118660880 AGAAGAAAAAAAAATTAGCTGGG + Intergenic
1060377414 9:123129194-123129216 AGAAAAACAAAAAATTAGCTGGG + Intronic
1060654082 9:125356660-125356682 AAATAAAAACAAAATCAGCCAGG - Intronic
1060699898 9:125741558-125741580 ATATGAAGACAAAATCAACATGG - Intergenic
1060926143 9:127456703-127456725 AAATAAAAAAAAAATCAGCTGGG + Intronic
1061127614 9:128686812-128686834 AGATAAAAACAAAATTAGCCAGG + Intronic
1061300112 9:129699261-129699283 ATATACACACAAAATTAGCTGGG + Intronic
1061311276 9:129764355-129764377 AGCTGAAGACACAATCAGCTTGG + Intergenic
1061810285 9:133158437-133158459 ATATTAATACAAAAACAGCTGGG - Intronic
1185537749 X:875759-875781 AGATAACCATAGAATCAGCTAGG + Intergenic
1185581815 X:1215605-1215627 AGAAAAACAAAAAATCAGCCAGG - Intergenic
1185678014 X:1864522-1864544 AAATAAAAAAAAAATCAGCTAGG - Intergenic
1186565833 X:10661471-10661493 AAATATACAAAAAATCAGCTGGG - Intronic
1186960194 X:14728230-14728252 AGTTAAACAAAAAATTAGCTGGG + Intronic
1189977744 X:46479266-46479288 AAAAATACACAAAATCAGCTGGG + Intronic
1190250132 X:48717060-48717082 ACATGTACACAAAATCAGATTGG + Intergenic
1192351478 X:70360173-70360195 AGAAGAAAAAGAAATCAGCTAGG - Intronic
1192379033 X:70595240-70595262 AAATACACACAAAATTAGCTGGG - Intronic
1192559688 X:72118583-72118605 AGAGGAAGACAAAATTAACTGGG - Intergenic
1192738480 X:73871273-73871295 AAAAGAATACAAAATTAGCTGGG - Intergenic
1192917064 X:75664112-75664134 AAATGAAAACAAAATAAGCAGGG - Intergenic
1193344203 X:80386779-80386801 ATATGAAAACAAAATCAACAGGG + Intronic
1193743757 X:85249496-85249518 AGATGAAAAAAAAATCTGATTGG + Intronic
1194156046 X:90390200-90390222 AGATGAACCAAAGAACAGCTAGG + Intergenic
1196734077 X:118969449-118969471 AAAATAATACAAAATCAGCTGGG + Intergenic
1197197268 X:123715484-123715506 AGAAGAAAAAAAAATCAGCCAGG + Intronic
1197802773 X:130369332-130369354 AGGTGAACACAAAAACAGTAAGG - Intronic
1198366284 X:135943182-135943204 AGATGAAGAAACAATCAGCATGG + Intergenic
1198728951 X:139706784-139706806 AAATAAACACAAAATCAGGGGGG + Intronic
1200502396 Y:3967173-3967195 AGATGAACCAAAGAACAGCTAGG + Intergenic
1200881246 Y:8213872-8213894 ATATGAACAAGAAATCAGCAAGG - Intergenic