ID: 1055123964

View in Genome Browser
Species Human (GRCh38)
Location 9:72697261-72697283
Sequence GGTTGCACAAAAGTAGAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 101
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 80}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055123964_1055123966 -3 Left 1055123964 9:72697261-72697283 CCCAGCTCTACTTTTGTGCAACC 0: 1
1: 0
2: 0
3: 20
4: 80
Right 1055123966 9:72697281-72697303 ACCTAATTTGCTTATATCTTTGG No data
1055123964_1055123969 6 Left 1055123964 9:72697261-72697283 CCCAGCTCTACTTTTGTGCAACC 0: 1
1: 0
2: 0
3: 20
4: 80
Right 1055123969 9:72697290-72697312 GCTTATATCTTTGGGATACTTGG No data
1055123964_1055123968 -2 Left 1055123964 9:72697261-72697283 CCCAGCTCTACTTTTGTGCAACC 0: 1
1: 0
2: 0
3: 20
4: 80
Right 1055123968 9:72697282-72697304 CCTAATTTGCTTATATCTTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055123964 Original CRISPR GGTTGCACAAAAGTAGAGCT GGG (reversed) Intronic
902536468 1:17121754-17121776 GGCGGCACAAAAGCAGAGCTGGG - Intergenic
905671037 1:39789903-39789925 GGTCACACAGCAGTAGAGCTGGG + Intergenic
906645873 1:47474554-47474576 GCTTTCAGAAAATTAGAGCTGGG + Intergenic
908240191 1:62182616-62182638 GTTTGCACAAAAGGAGGGTTCGG + Intergenic
912266003 1:108159083-108159105 GATTGCACAATAATAGAACTTGG + Intronic
912706809 1:111920777-111920799 GGTTACACAAAGGAAGAGGTTGG - Intronic
913303787 1:117401503-117401525 TCTTTCACAAAAGTAGGGCTGGG + Intronic
920721531 1:208391894-208391916 GATTGAACAAAAAGAGAGCTAGG - Intergenic
920928739 1:210367238-210367260 GGTCCCACAAAAGCAGGGCTGGG + Intronic
921607246 1:217170199-217170221 GGTGGCACAAAACTATAGATGGG - Intergenic
922907523 1:229185710-229185732 TGTTACATAAAAGTTGAGCTGGG - Intergenic
1063319142 10:5036329-5036351 GTTTGCACAAAAGGAGAGTTTGG - Intronic
1063869830 10:10405313-10405335 GGTGGCACACAAGGAGAGCATGG + Intergenic
1070802716 10:79252966-79252988 GAATGAACAAAAGAAGAGCTGGG + Intronic
1070909622 10:80106464-80106486 GTTTGCACAAAAGGAGAGTTTGG - Intergenic
1071722633 10:88162936-88162958 GGTTGCAGAATATCAGAGCTTGG - Intergenic
1077992535 11:7424785-7424807 GTATGCACAAAGGTTGAGCTTGG - Intronic
1078728955 11:13958724-13958746 GGTCGCAGAAGAGAAGAGCTGGG - Intergenic
1079060392 11:17243691-17243713 GGTTACACAGAAGCAGAGCTAGG + Intronic
1081547348 11:44080936-44080958 GGTTGAACAAATGAAGAGATGGG - Intronic
1084721873 11:70911542-70911564 GGTTGCAAAAAAGGAGAAGTTGG - Intronic
1086137598 11:83457673-83457695 GGTGGCCTAAAAATAGAGCTGGG + Intronic
1089113413 11:116074650-116074672 GGTTGCAGAAGAGTGGAGCATGG - Intergenic
1091064189 11:132493249-132493271 ATGAGCACAAAAGTAGAGCTCGG + Intronic
1092503586 12:9072164-9072186 GGTTGCACAATAGTAGATCCTGG + Intronic
1092854788 12:12662888-12662910 GGTTGCAAAAGAGGAAAGCTTGG + Intronic
1095929051 12:47607497-47607519 GGTTTCACAAGTTTAGAGCTGGG + Intergenic
1096040166 12:48508273-48508295 GTTTGCACAAAAGGAGAGTTTGG - Intronic
1098660019 12:73081229-73081251 GGTAGAACAAAAGAAGAGCATGG + Intergenic
1099133946 12:78870040-78870062 GTTTGTACAAAATGAGAGCTGGG + Intronic
1110902206 13:80837391-80837413 GGTGGCACTAAAGTACAGCTTGG - Intergenic
1113543860 13:111131315-111131337 GGTTGCACAACAGGATAGATGGG + Intronic
1120091487 14:80337339-80337361 GGTAGCAGAGAAGTAGAGGTAGG + Intronic
1120123027 14:80705525-80705547 GGTTGAAGAAAAGTGGGGCTGGG + Intronic
1122604838 14:102941193-102941215 GCTTGCAGAAACGCAGAGCTGGG + Intronic
1129530951 15:76264160-76264182 GTTTTCACAAAAGGAGAGTTCGG - Intronic
1134010639 16:10849788-10849810 GGTAGCAAAAAACTGGAGCTGGG + Intergenic
1151588161 17:75024127-75024149 GTTTGCACAAAAGGAGAGTTCGG - Intergenic
1155321732 18:24625726-24625748 GCTGGAGCAAAAGTAGAGCTTGG - Intergenic
1155461702 18:26090813-26090835 GGGTGCCCATAAGGAGAGCTCGG - Intronic
1157744713 18:50125025-50125047 GGCTCCCCAAAAGTAGGGCTAGG - Intronic
1157947407 18:51996489-51996511 GGTTGTACAACAGTAGAGATGGG + Intergenic
1165945732 19:39441121-39441143 GCTTGCACATAAGTACAGCATGG + Intronic
1166973110 19:46583771-46583793 GGATACACTAAAGTAGTGCTTGG + Intronic
1167658345 19:50780835-50780857 GTTTGCACACAAGTAGAGATGGG - Intergenic
1167754195 19:51401142-51401164 GTTTGCACAAAAGGAAAGTTCGG + Intergenic
925726839 2:6881449-6881471 GGCTAGAGAAAAGTAGAGCTAGG - Intronic
933615156 2:84476159-84476181 GTTTGCACAAAAGGAGAATTTGG + Intergenic
935722410 2:105991111-105991133 GTTTGCACAAAAGGAGAGTTTGG - Intergenic
941444150 2:165580172-165580194 AGTTTCACAAAAGTAGAGTCAGG - Intronic
944842707 2:203639746-203639768 GGATGCAGAAAAGGAGAGGTGGG + Intergenic
948957706 2:241306734-241306756 GCATGCACAATAGTAGAGATAGG - Intronic
1177606948 21:23392250-23392272 GGTTGCTGAAAGGTAGAGTTAGG + Intergenic
1181388301 22:22560084-22560106 GGTCTCAGAAAAGGAGAGCTGGG - Intronic
1182491948 22:30678697-30678719 GTTTGCACAAAAGGAGGGTTCGG + Intergenic
951388979 3:22079451-22079473 GGTTCAACAAAAGTTTAGCTTGG + Intronic
952257741 3:31710087-31710109 AGATGCACAAAAGGAAAGCTTGG + Intronic
952586407 3:34898222-34898244 GGTTGTACCAAAGAAGAGATTGG - Intergenic
952808935 3:37384493-37384515 GGTTGAACAAAACTAAAGCCAGG + Intergenic
952854301 3:37755217-37755239 AGCTGCTAAAAAGTAGAGCTGGG + Intronic
958840591 3:99199985-99200007 GGTTGCACAGAGGTAGGGCAAGG - Intergenic
958904063 3:99922800-99922822 GGCTGCAAAAAAGGAGAGTTTGG - Intronic
961105797 3:124240300-124240322 AGCTGCAGAAAGGTAGAGCTGGG - Intronic
965701248 3:171460684-171460706 GGCCACACAAAAATAGAGCTTGG - Intergenic
976349116 4:84040466-84040488 GGTTTCAAGAAAGTATAGCTTGG - Intergenic
978305994 4:107329311-107329333 GTTTGCACAAAAGAAGAGTTTGG - Intergenic
978384442 4:108166825-108166847 GGTTGGAGAAAACTAGAGTTGGG + Intronic
980986209 4:139697097-139697119 GGTTGTACAAAAAAAAAGCTTGG - Intronic
981246558 4:142547466-142547488 GGTTGCAGAAAATTAGTGCAGGG - Intronic
986494400 5:8328169-8328191 GGTTCCACAAAAGGGGAACTTGG + Intergenic
987923141 5:24309270-24309292 GGATGCACAAACAAAGAGCTGGG - Intergenic
987923449 5:24312126-24312148 GTTTGCACAAAAGGAGAGTTCGG + Intergenic
990476151 5:56163409-56163431 GGTAACACAAAATGAGAGCTCGG - Intronic
995180240 5:109224226-109224248 GCTGGCACAGAAGTAGAGCCAGG - Intergenic
997232296 5:132253833-132253855 AATGGCACAAAACTAGAGCTGGG + Intronic
998664056 5:144275568-144275590 GGTGTCACAAAAGCAGAACTGGG - Intronic
999637224 5:153635463-153635485 GGCTGCACAAAGGCAGAGCTAGG + Intronic
1004814613 6:19299393-19299415 GGTTGAACTAAAGGGGAGCTGGG - Intergenic
1006987184 6:38183687-38183709 GGTTGCACAAAAATATAGGCTGG - Intronic
1010685930 6:78855397-78855419 GTTTGCACAAAAGGAGAGTTTGG - Intergenic
1010842675 6:80665847-80665869 GGTTACACAGCAGTAGAGCTGGG + Intergenic
1015019381 6:128453750-128453772 AGTAGCACCAATGTAGAGCTTGG - Intronic
1017563850 6:155663084-155663106 GGAACCAAAAAAGTAGAGCTGGG + Intergenic
1022623305 7:32007344-32007366 GCTAGAAAAAAAGTAGAGCTAGG - Intronic
1028569585 7:92271852-92271874 AGTTCCAAAAAAGTAGAGCAGGG + Intronic
1032924524 7:136588412-136588434 CTTAGCACAAAAATAGAGCTGGG - Intergenic
1033085776 7:138340400-138340422 GTTTGCACAAAAGGAGAATTTGG - Intergenic
1038108621 8:24467431-24467453 GGTTGTATAAAAGTAGTCCTTGG + Intronic
1048193087 8:132308161-132308183 GGTTGAATAAAAACAGAGCTGGG + Intronic
1048725527 8:137379435-137379457 GGTTACACAAAAATAGATCTGGG - Intergenic
1050190681 9:3022522-3022544 GGTTGGACAAAAATAGTGTTAGG - Intergenic
1055123964 9:72697261-72697283 GGTTGCACAAAAGTAGAGCTGGG - Intronic
1057413036 9:94835215-94835237 GGTTGGACAAGAGTCTAGCTAGG + Intronic
1060242951 9:121920355-121920377 GGTAGCACAAAAGCAGAGCCAGG + Intronic
1060821330 9:126663052-126663074 GGTTGCACAGCAATAGAGCCAGG - Intronic
1185735396 X:2491947-2491969 GGTTGCCCAAAATGACAGCTGGG + Intronic
1187847066 X:23550773-23550795 TGTTGCACAAAAGAAAAGCATGG + Intergenic
1190792122 X:53710344-53710366 GGTTTCACGAAAGTAGAACCTGG + Intergenic
1195060380 X:101188642-101188664 GTTTGCACAAAAGAAGAGTTCGG + Intergenic
1197652755 X:129083800-129083822 AGTTGTAGAAAAGTTGAGCTAGG - Intergenic
1198750154 X:139931571-139931593 GGTGGCCCAAAAGAAGAGCTGGG - Intronic