ID: 1055128893

View in Genome Browser
Species Human (GRCh38)
Location 9:72752119-72752141
Sequence GCTCCCAATCCTTGCACTAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 102
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 89}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055128889_1055128893 4 Left 1055128889 9:72752092-72752114 CCTTCAAAATGGTGCCCATGGGC 0: 1
1: 0
2: 1
3: 11
4: 98
Right 1055128893 9:72752119-72752141 GCTCCCAATCCTTGCACTAAAGG 0: 1
1: 0
2: 0
3: 12
4: 89
1055128890_1055128893 -10 Left 1055128890 9:72752106-72752128 CCCATGGGCCAAAGCTCCCAATC 0: 1
1: 0
2: 1
3: 2
4: 109
Right 1055128893 9:72752119-72752141 GCTCCCAATCCTTGCACTAAAGG 0: 1
1: 0
2: 0
3: 12
4: 89

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055128893 Original CRISPR GCTCCCAATCCTTGCACTAA AGG Intronic
900579693 1:3402954-3402976 GCTCGCAGTCCTTGCACTCGTGG - Exonic
902209107 1:14892142-14892164 GCTCCCATTCCTGGCCCAAATGG + Intronic
903886045 1:26541813-26541835 CCTGCCAATCCTGGCCCTAACGG - Intronic
904651102 1:32006551-32006573 GCTCCCAATCCCAGCACTTTGGG - Intergenic
904755640 1:32767013-32767035 CCTGCCCATCCTTCCACTAAGGG + Intronic
906944805 1:50286604-50286626 GATCACAATCCCTGCCCTAAAGG + Intergenic
909417437 1:75423078-75423100 TCTTCCAATCCTTGCAACAAAGG - Intronic
909795871 1:79735211-79735233 CATTCCAAGCCTTGCACTAAAGG - Intergenic
912805031 1:112749295-112749317 GGTCCCAATCATTGAAATAAGGG - Intergenic
921887576 1:220321933-220321955 GCCTCCAATCCTAGCACCAAAGG - Intergenic
924215057 1:241812479-241812501 GCTCCCAAGCCTGGGACTAAGGG + Intergenic
1067581731 10:47450673-47450695 GGACCCAATGCTTGCACTGAGGG + Intergenic
1070742480 10:78912091-78912113 GCTCCGTATCCTTGCTCCAAAGG - Intergenic
1074182169 10:111075270-111075292 TCTCCCAATCTTTGCCCTAATGG - Intergenic
1076043198 10:127269011-127269033 GCTTCCAACCCTTGTACTGAAGG - Intronic
1079242321 11:18729551-18729573 CCTCCCAATCCCTGCACTGAGGG + Exonic
1083348868 11:62013169-62013191 GCTCAGAGTCCTTGCCCTAAGGG - Intergenic
1086818454 11:91403722-91403744 GCTCCCAATCCTTTCTTAAAAGG + Intergenic
1090847881 11:130546007-130546029 GCTCCCAACCCATTCACTACAGG - Intergenic
1093480705 12:19601435-19601457 GCCCCCAACCCTTGTACTATGGG - Intronic
1096192844 12:49631499-49631521 GCCCCCAATGCTTCCACCAATGG + Exonic
1107844527 13:44497934-44497956 GCTCCTTATCCTAGCACAAAAGG + Intronic
1108358980 13:49652427-49652449 CCTCCCAACCCTTCCCCTAAAGG + Intergenic
1119481115 14:74958519-74958541 GCTACCATTCTTTGCACCAAAGG - Intergenic
1119641120 14:76315688-76315710 GCTCCCACACCTTCCACTAAGGG + Intronic
1122665985 14:103329977-103329999 GCTCACAGTCCGTGCACTAATGG - Intergenic
1122981477 14:105194132-105194154 GCTCCAAATCATTGCTCTGAGGG + Intergenic
1128743029 15:70096450-70096472 GCTCCCATGCCTTTCACCAAGGG + Intronic
1129459867 15:75695191-75695213 CCTACCCACCCTTGCACTAAAGG + Intronic
1130764599 15:86857312-86857334 GCTTCCCATCCTTCCAGTAAAGG + Intronic
1141269030 16:82522289-82522311 GCTCTCAATCCCAGAACTAATGG + Intergenic
1145886947 17:28388512-28388534 GCACCCAATCCTTGCAGTCATGG - Exonic
1146503550 17:33384936-33384958 ACTCCTAATCCTTGCATTATGGG - Intronic
1147295449 17:39478451-39478473 GCTTCCAATCCCAGCACTATGGG - Intronic
1148638595 17:49168208-49168230 GCTGCCTATCCATGCACTCATGG - Intronic
1156889085 18:42169231-42169253 GGTTCCATTCCTTGCTCTAATGG - Intergenic
1159579241 18:70216729-70216751 TCTCTAAATCCTAGCACTAAGGG + Intergenic
1160516037 18:79479809-79479831 TCTCCCTGTCCTTGCCCTAAGGG - Intronic
1160746817 19:715625-715647 ACTCCCCATCCTGGCACTCAAGG - Intronic
1164577990 19:29417308-29417330 GCTCCCAATCCTTGCCTTCTGGG + Intergenic
925018820 2:552862-552884 GCACCCCATCCTTGCAGCAATGG + Intergenic
930312014 2:49753837-49753859 GCTCCCACTCCCTCCACTGAAGG - Intergenic
935582071 2:104764967-104764989 GTTTCCAATCCTTCCAATAATGG - Intergenic
936635240 2:114248769-114248791 GCTCCCAATCCATGATTTAAGGG - Intergenic
938236036 2:129708093-129708115 GATCACACTCCCTGCACTAATGG + Intergenic
940900414 2:159121587-159121609 GCTCACAATCCTAGCACTTTGGG - Intronic
945891702 2:215436642-215436664 GCTCCCTTTCTTTGGACTAAAGG + Intergenic
948449660 2:238061151-238061173 GCTCCCCAGCCCTGCCCTAAAGG - Intronic
1170627380 20:18040181-18040203 GCTCGTAATCCTTGCACTTAAGG - Intronic
1172136357 20:32689389-32689411 GCTCCCAACCCATTCACTACAGG - Intergenic
1172612783 20:36264194-36264216 CCTCTCTGTCCTTGCACTAAAGG + Intronic
1174317663 20:49714885-49714907 TCACCCAAGCCTTGCAGTAAGGG + Intergenic
1174598215 20:51701899-51701921 GCTCCCAATCCTAGCACTTTGGG + Intronic
1175336429 20:58199216-58199238 GCTCCCACTCCCTGCCCCAAGGG + Intergenic
1180985816 22:19903453-19903475 GCTCCAAAACCTGGCACTGAGGG + Intronic
1184736245 22:46399331-46399353 GCTCCCCATCCATGCTCTGAGGG + Intronic
950031965 3:9859588-9859610 GCTTCCAATCCTTGCACCTCAGG - Intergenic
950673049 3:14538739-14538761 GCTCCTAAGCCTTGCATTCAAGG - Intronic
950950073 3:16989682-16989704 CCTCCCAATACTGTCACTAAGGG + Intronic
954322119 3:49839410-49839432 GCACGCACTCCTGGCACTAAGGG + Intronic
961784720 3:129341024-129341046 GCTCCCAATCCTTGCACCTCAGG - Intergenic
975935141 4:79570511-79570533 GCTACAAATCCTTCCACAAATGG + Intergenic
976568209 4:86576853-86576875 GATCCCAAACCTTCCACTGAGGG + Intronic
978842812 4:113234459-113234481 ACTCTCAATGCCTGCACTAATGG + Intronic
979307046 4:119158294-119158316 GCTCCCAATCCCAGCACTTTGGG + Intronic
985585434 5:730634-730656 CCTCCCAATCCTTGTATTATGGG + Intronic
985598946 5:814957-814979 CCTCCCAATCCTTGTATTATGGG + Intronic
985599871 5:822061-822083 CCTCCCAATCCTTGTATTATGGG + Intronic
985851237 5:2390257-2390279 GCTTCCGATACCTGCACTAAAGG - Intergenic
986651770 5:9971128-9971150 GCTACCAACCCAAGCACTAAAGG - Intergenic
997437066 5:133883312-133883334 GTTCCCAATCCCCGCACCAAGGG + Intergenic
1002968737 6:1992654-1992676 ACTCCCAATCCTTGGCCTACAGG + Intronic
1004034541 6:11910469-11910491 GCTCCCAATCCTAGTCCCAAGGG - Intergenic
1006358202 6:33573012-33573034 GCTCCCAACCCATTCACTACAGG - Exonic
1008366629 6:50688326-50688348 GCTCCCCCTCCTTGCACTGAGGG - Intergenic
1013586795 6:111586429-111586451 CCTCCGAATCCTTCCACTGAAGG - Intronic
1014978687 6:127921137-127921159 CCTCCCCAACCCTGCACTAAGGG + Intergenic
1015609808 6:135004587-135004609 GATCCTAATGCTTGCTCTAACGG + Intronic
1019606450 7:1912585-1912607 GCTCCCCATCCCTGCACCAGTGG + Intronic
1022813267 7:33889662-33889684 GATAACAATCCTTGCTCTAATGG - Intergenic
1024902714 7:54339419-54339441 GCTCCAACTCCTTGGACTGAAGG + Intergenic
1027189036 7:75987359-75987381 CCTGCCACTCCTTGCACTGAGGG + Exonic
1028847904 7:95503472-95503494 GGTCCCCATCCATGCACTCAGGG - Intronic
1031994596 7:128221471-128221493 GCCCCCAATCCTTGCAGAGAGGG + Intergenic
1032104292 7:129012630-129012652 GGTCCCAAGCCTTTCAGTAAGGG + Intronic
1034556661 7:151854683-151854705 GCTCCCACTCCTTGAGCTCAGGG + Intronic
1035070648 7:156143017-156143039 GCTTCCTACCCTTGCTCTAAAGG + Intergenic
1037121497 8:15293056-15293078 CTTCCCTACCCTTGCACTAAAGG + Intergenic
1042838880 8:73103683-73103705 GGTCCCTATCCATGCAATAAAGG + Intronic
1047695944 8:127403812-127403834 GGTCCCAAACCTAGGACTAAGGG - Intergenic
1049103182 8:140594016-140594038 GGTGCCAAGCCCTGCACTAAGGG + Intronic
1055128893 9:72752119-72752141 GCTCCCAATCCTTGCACTAAAGG + Intronic
1055261313 9:74437212-74437234 GCTTCCAATCCTTGCAAAAAGGG - Intergenic
1056536696 9:87534331-87534353 TCTCCCAATCATTGCTCTCAAGG + Intronic
1060301288 9:122375947-122375969 GCTCCCAACCCTGGCACACAAGG - Intronic
1061446502 9:130641293-130641315 GCCCCCAAGCATGGCACTAAAGG + Intergenic
1188141969 X:26561943-26561965 GCTACCAATCTTAGGACTAAAGG + Intergenic
1188196976 X:27247759-27247781 TCTCCTAATTCTTGTACTAATGG + Intergenic
1189829652 X:44958114-44958136 TCTGACAATCCTTACACTAAAGG + Intronic
1198125631 X:133640904-133640926 GGTCCCCACCCTTGCACTAAGGG - Intronic
1199889054 X:152056834-152056856 GCTTGTAATCCTAGCACTAAGGG - Intergenic
1200059818 X:153479277-153479299 GCTCCCCATCCTGGCACTGTGGG + Intronic