ID: 1055135511

View in Genome Browser
Species Human (GRCh38)
Location 9:72824567-72824589
Sequence GGGAAGAGTCGGCCTGACTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 191
Summary {0: 1, 1: 0, 2: 3, 3: 27, 4: 160}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055135511_1055135523 29 Left 1055135511 9:72824567-72824589 CCAAAGTCAGGCCGACTCTTCCC 0: 1
1: 0
2: 3
3: 27
4: 160
Right 1055135523 9:72824619-72824641 ACTGAGTCTGTGGTCTTTATAGG No data
1055135511_1055135520 19 Left 1055135511 9:72824567-72824589 CCAAAGTCAGGCCGACTCTTCCC 0: 1
1: 0
2: 3
3: 27
4: 160
Right 1055135520 9:72824609-72824631 CCCTCTACCAACTGAGTCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055135511 Original CRISPR GGGAAGAGTCGGCCTGACTT TGG (reversed) Intronic
900251795 1:1674772-1674794 GGGAAGTGTCTGTCTGCCTTTGG - Intronic
900262203 1:1737628-1737650 GGGAAGTGTCTGTCTGCCTTTGG - Intronic
901741344 1:11344060-11344082 TGGAAGAGTGGGCCTGTCCTGGG + Intergenic
903382256 1:22905470-22905492 GGGAAGAGGAGGCTTGAATTAGG + Intronic
904174063 1:28613378-28613400 GGGAAGAGTCAGCACGACATTGG + Intronic
905855869 1:41313419-41313441 GAGTAAAGTCTGCCTGACTTTGG - Intergenic
907615942 1:55926906-55926928 GGGAAGAGACAACCTGACTTTGG + Intergenic
907616302 1:55930242-55930264 GGGAAGAGACAACCTGACTTTGG - Intergenic
909926145 1:81439959-81439981 AGGAGGAGACAGCCTGACTTTGG - Intronic
909997467 1:82298240-82298262 GTGAAGACTGGGGCTGACTTTGG + Intergenic
915271635 1:154757817-154757839 GAGAAGATTCAACCTGACTTTGG + Intronic
918045462 1:180938510-180938532 GGGATGAGCCGGTCTGACTCAGG + Intronic
921096079 1:211888280-211888302 AGAAAGAGTAGGCCTGAGTTAGG + Intergenic
923906437 1:238390483-238390505 GGGGAAAGTTGGCCTGACTCTGG + Intergenic
1073728788 10:106267335-106267357 GGGAAGGGATAGCCTGACTTCGG + Intergenic
1073771380 10:106739158-106739180 GGGAAGAGTGGGCCAAACTCTGG - Intronic
1074097422 10:110326220-110326242 GGGAAGAGTTTCCCTCACTTTGG + Intergenic
1074945130 10:118274214-118274236 GGGAGGAGTCGGGCTGACAGAGG + Intergenic
1077300920 11:1846560-1846582 GGGGAGAGTCGGGCTGACTCTGG - Intergenic
1078507721 11:11965025-11965047 GGCAGGAGTCAGCCTGACTCTGG + Intronic
1079646194 11:22866296-22866318 GGGAAGAGATGGCCTGACTTTGG + Intergenic
1079646202 11:22866342-22866364 GGGAAGAGACAACCTGACTTTGG + Intergenic
1080390862 11:31845129-31845151 GTAAAGAGTCGGCCTGTTTTTGG - Intronic
1081689253 11:45065578-45065600 GGGGAGAATTGGGCTGACTTGGG - Intergenic
1083246130 11:61429698-61429720 GCGAAGAGTAGGCCTGGGTTGGG - Intronic
1084646747 11:70463484-70463506 GGGAAAGGTGGGCCTGGCTTTGG + Intergenic
1084783952 11:71430763-71430785 GAGGGGAGACGGCCTGACTTTGG - Intronic
1084875019 11:72124676-72124698 CAGAAGAGATGGCCTGACTTCGG - Intronic
1085465837 11:76722614-76722636 GGGCACAGTCTGCCTGACCTTGG - Intergenic
1089428555 11:118401557-118401579 GAAAAGAGGCGGCCTGACCTTGG + Exonic
1091845848 12:3655850-3655872 GGGAAGAGACAGGCTGACCTTGG + Intronic
1100607429 12:96163146-96163168 GGGAAAAGACTTCCTGACTTTGG - Intergenic
1101609734 12:106279553-106279575 GGGAAGAGACGACTTGACTTCGG - Intronic
1101988059 12:109462655-109462677 GGGAAGAGCCTGCCTCTCTTGGG - Intronic
1103341138 12:120221790-120221812 GGGAAGTGTGGGGCTGACTGTGG - Intronic
1103832127 12:123788359-123788381 GGGAAGACTGGGCCTGGCTGAGG - Intronic
1104339010 12:127929970-127929992 GGGAAGAGACAACCTGACTTTGG + Intergenic
1111608688 13:90575980-90576002 GGGAAGAGATGGCCAGAATTTGG + Intergenic
1114134797 14:19835006-19835028 GGGTAGAGTCAGCATAACTTGGG - Intergenic
1117049659 14:51847442-51847464 GGTAAGAGTAGCCCTGACTACGG + Intronic
1117928567 14:60812765-60812787 AGGAAGAGACAACCTGACTTCGG + Intronic
1118486133 14:66215915-66215937 GGGAAGAGATGGCCTAACTTTGG + Intergenic
1121245953 14:92460922-92460944 GGGAAGAGTTTGCCTGTATTGGG - Intronic
1122826788 14:104374471-104374493 GGGCAGACTCGGCCTCACGTTGG + Intergenic
1123577849 15:21690579-21690601 GGGTAGAGTCAGCATAACTTGGG - Intergenic
1123614473 15:22133060-22133082 GGGTAGAGTCAGCATAACTTGGG - Intergenic
1124215538 15:27805128-27805150 GGGGAGAGTGGGCCTGGCTGAGG + Intronic
1125919575 15:43517616-43517638 GGGAAGAGTCTGCAGCACTTAGG - Exonic
1127493290 15:59485046-59485068 GGGAAGAGTGGGAAGGACTTTGG + Intronic
1202986718 15_KI270727v1_random:424824-424846 GGGTAGAGTCAGCATAACTTGGG - Intergenic
1133543844 16:6786109-6786131 GGCAAAAGTCTGCATGACTTTGG + Intronic
1134032816 16:11006190-11006212 GGGTACTGTGGGCCTGACTTGGG + Intronic
1135786176 16:25351258-25351280 GGGAAGAGTTAGCCTAATTTGGG - Intergenic
1136720105 16:32313208-32313230 GGGAGGAGTTCGCCCGACTTGGG + Intergenic
1136838482 16:33519487-33519509 GGGAGGAGTTCGCCCGACTTGGG + Intergenic
1136843486 16:33557655-33557677 GGGAGGAGTTCGCCCGACTTGGG + Intergenic
1203006326 16_KI270728v1_random:204561-204583 GGGAGGAGTTCGCCCGACTTGGG - Intergenic
1203148646 16_KI270728v1_random:1819772-1819794 GGGAGGAGTTCGCCCGACTTGGG + Intergenic
1203153651 16_KI270728v1_random:1857953-1857975 GGGAGGAGTTCGCCCGACTTGGG + Intergenic
1143201869 17:5118797-5118819 GGGAAGAAATGGCCAGACTTTGG - Intronic
1143706785 17:8703588-8703610 AGGAAGAGACAACCTGACTTTGG - Intergenic
1146549566 17:33768837-33768859 GGGAGGAGATGGCATGACTTTGG + Intronic
1146549569 17:33768859-33768881 GGGAAGAGACCTCCTGACTTTGG + Intronic
1148239230 17:45989015-45989037 GGAAAGATTCTACCTGACTTAGG - Intronic
1148564864 17:48626743-48626765 GGGAAGCGGCGGGCTGCCTTGGG + Intronic
1148746979 17:49924029-49924051 TGGAAGAGGCAGCCTGGCTTTGG + Intergenic
1149548781 17:57524212-57524234 GGGAAGAGTATGCCTGTTTTGGG - Intronic
1149644240 17:58228126-58228148 GTGAAGAGACAACCTGACTTTGG - Intronic
1151192508 17:72408730-72408752 GGGAAGATTAGTCCTGCCTTCGG - Intergenic
1151474600 17:74338539-74338561 GGGAAGAGGAGGCCTGACCCTGG - Intronic
1155525583 18:26713268-26713290 GGGAAGAGAGAGGCTGACTTGGG + Intergenic
1155839090 18:30625633-30625655 TGGAAGAGACAGCCAGACTTTGG - Intergenic
1156511486 18:37640657-37640679 GGGAAGAGTCAGCATGAGGTAGG + Intergenic
1157708162 18:49826791-49826813 GGGGAGAGAAGCCCTGACTTAGG + Intronic
1160043382 18:75365624-75365646 GGGAAGAGAAGGCCTAACATGGG + Intergenic
1164616850 19:29672411-29672433 GGGAAGAGGCTGCCTGAGCTGGG + Intronic
1164633361 19:29775858-29775880 GAGAAGAGTCTGCCTGTCTGGGG - Intergenic
1166750800 19:45163225-45163247 TGGAAGAGAAGGCCTGGCTTAGG + Intronic
1167399415 19:49255124-49255146 GGGAAGAGTTGGGCTGTGTTGGG + Intergenic
1168568025 19:57440762-57440784 GAGAAGAGTGAGCCTGAGTTTGG + Intronic
925503507 2:4533852-4533874 GGGAAGAGTCAACCTGTGTTTGG + Intergenic
932360760 2:71103762-71103784 AGGAGGAGATGGCCTGACTTTGG + Intergenic
933026869 2:77271015-77271037 GGGAAGAGAAAGCCTGACTTCGG + Intronic
934760653 2:96854352-96854374 CGGCCGAGTCGGGCTGACTTGGG + Exonic
935830900 2:106999861-106999883 GGAGAGAGTTGGCCAGACTTTGG + Intergenic
935830906 2:106999907-106999929 GGGAAGAGACAGCTGGACTTCGG + Intergenic
938089569 2:128422419-128422441 GGGAGGAGACCTCCTGACTTTGG - Intergenic
938977654 2:136495087-136495109 GGTAAGAGGTGGCCAGACTTGGG - Intergenic
940173146 2:150850103-150850125 AGGAAGAGACCTCCTGACTTTGG - Intergenic
941968474 2:171323773-171323795 GGGAAGAGTCTGACTGTGTTTGG + Exonic
946907412 2:224430080-224430102 GGGAGGAGACCTCCTGACTTCGG + Intergenic
947484845 2:230538642-230538664 AGGAAGAGTCCCCATGACTTAGG - Intronic
1174036944 20:47674285-47674307 GGCCAGTGTCGGCTTGACTTGGG + Intronic
1174113924 20:48214261-48214283 GTGCAGAGGCGGCCTGCCTTGGG - Intergenic
1174167920 20:48598272-48598294 GTGCAGAGGCGGCCTGCCTTGGG + Intergenic
1174348844 20:49952294-49952316 GGGAAGAGAAGGGCTGACCTGGG - Exonic
1174891320 20:54398279-54398301 GGGAAGAGACAACCTGACTTTGG + Intergenic
1175920251 20:62447207-62447229 GGGACCAGCCAGCCTGACTTGGG - Intergenic
1176365794 21:6032112-6032134 GGGCAGAGCCGGCCAGACTATGG - Intergenic
1177385034 21:20397351-20397373 TGGAAGAGACACCCTGACTTTGG - Intergenic
1179757722 21:43506433-43506455 GGGCAGAGCCGGCCAGACTATGG + Intergenic
1181341315 22:22182205-22182227 GGGAGGGGTGGGCCTAACTTGGG - Intergenic
1182076749 22:27500145-27500167 AGGTAGAGTGTGCCTGACTTAGG + Intergenic
1182218367 22:28738314-28738336 GGGAAGACTCAGCCTGGCTCAGG - Intronic
950315671 3:11999946-11999968 TGAAAGTGTCTGCCTGACTTGGG - Intergenic
953302593 3:41793822-41793844 GGAAGGAGTGGACCTGACTTGGG - Intronic
956301282 3:67775217-67775239 GGGAAGAGATGGCTGGACTTCGG - Intergenic
960146388 3:114208493-114208515 GGGAATAGTCAACCTGACTGTGG + Intergenic
962119598 3:132548008-132548030 GAGAAGAGCTGGCCAGACTTTGG + Intergenic
969317831 4:6392735-6392757 GGGAAGCCACGGTCTGACTTAGG + Intronic
973022472 4:45220561-45220583 GGGAAGAGGCCTCTTGACTTTGG - Intergenic
973136148 4:46709107-46709129 GGGAAGAAACAGCCTGACTTTGG + Intergenic
973705547 4:53576444-53576466 GGGAAGAGTCAGCTGCACTTTGG - Intronic
974673259 4:65058301-65058323 GGGAAGAGACAACCTGACCTCGG + Intergenic
975615120 4:76238220-76238242 GGGAACATTCAGCCTGACCTGGG - Intronic
975830400 4:78362802-78362824 GGGAAGAGACAACCTGATTTTGG - Intronic
977969868 4:103200812-103200834 GAGAAGAGTGAGCCAGACTTGGG + Intergenic
980729127 4:136804615-136804637 GGGAAGAGACAACCTGACTTTGG + Intergenic
982216072 4:153083517-153083539 GGAAGCAGTCGGCCTGACCTGGG - Intergenic
984112957 4:175643089-175643111 GGGAAGAATCGGTCTGATTATGG - Intronic
985591099 5:765992-766014 GGGAACAGTTGGCCTGCGTTCGG - Intronic
985591194 5:766355-766377 GGGAGCAGACGGCCTGACATGGG + Intronic
986076207 5:4340503-4340525 GGGAAGAAACGGCCAGAGTTTGG - Intergenic
987039048 5:14044879-14044901 GGGTAGTGTGGGCCTGACATAGG - Intergenic
993293196 5:86101854-86101876 GGGAAGAGACAGCCAGACTTTGG + Intergenic
993293202 5:86101876-86101898 GGGAAGAGATGGCCGGACTTCGG + Intergenic
993378312 5:87176234-87176256 GGGTAGAGACAACCTGACTTTGG + Intergenic
997228549 5:132227437-132227459 GGGAAGTGGCGGCCTGACCCCGG - Intronic
1000684346 5:164228657-164228679 TAGAGGAGACGGCCTGACTTTGG + Intergenic
1001973716 5:175979261-175979283 GGGAAGAAATGGCCTGACTTCGG + Intronic
1002243716 5:177864518-177864540 GGGAAGAAATGGCCTGACTTCGG - Intergenic
1003112301 6:3260190-3260212 GAGAAGAGTCGGGCTCACTGAGG - Intronic
1003424984 6:5993010-5993032 GGGAAGGGTCAGCTGGACTTTGG - Intergenic
1003603275 6:7538035-7538057 GTGAAGACTCTGCCAGACTTTGG + Intergenic
1004955357 6:20722878-20722900 GGGTAGAGACAACCTGACTTTGG + Intronic
1005026423 6:21466881-21466903 GGGAAGAGACAACCTAACTTTGG + Intergenic
1006409570 6:33864722-33864744 GGGAAGAGACAGCCTGACTCTGG + Intergenic
1006461600 6:34162335-34162357 GGGGAGAGTCGGCCTGGCTCGGG + Intergenic
1007384335 6:41510489-41510511 GGGAAGAGCCAGCCTGGCTGGGG - Intergenic
1007709947 6:43816409-43816431 GAGCAGAGTTGGCCTAACTTGGG + Intergenic
1009523265 6:64711779-64711801 GGGAAGAGACAACCTGACTTCGG - Intronic
1009523269 6:64711801-64711823 AGGAGGAGATGGCCTGACTTCGG - Intronic
1010294709 6:74182647-74182669 GGGAAGAGATGGCTGGACTTTGG + Intergenic
1013216555 6:108032678-108032700 GGGAAGAGATGGCCAGATTTTGG - Intergenic
1016006930 6:139098935-139098957 AGGAGGAGACAGCCTGACTTTGG + Intergenic
1016084393 6:139894866-139894888 GGCCAGAGACGGCCAGACTTTGG - Intergenic
1017047032 6:150356478-150356500 GGGAAGAGACAACCTGACTTTGG - Intergenic
1019191373 6:170253010-170253032 GGGAAGAGCTGGACTGACCTCGG - Intergenic
1020466800 7:8489187-8489209 GGGAAGATTCGGCCTATCTAGGG + Intronic
1021386392 7:20035821-20035843 GGCAAGAGACAACCTGACTTAGG - Intergenic
1021645953 7:22789634-22789656 GAGAAGAGACAACCTGACTTCGG - Intergenic
1023353242 7:39341047-39341069 GGGGAGAGCCGGACTGACTGAGG - Intronic
1026918697 7:74139376-74139398 GGGAAAAGACGACCTGACTTCGG + Intergenic
1035917471 8:3640782-3640804 GGGAAGAGACGGCCTCACAGAGG + Intronic
1038215984 8:25562127-25562149 GAGAAGAGACAACCTGACTTTGG - Intergenic
1038216005 8:25562261-25562283 AGGAGGAGACGACCTGACTTAGG - Intergenic
1040458373 8:47622439-47622461 GGTAAGACTCGGCCTGAGTCAGG + Intronic
1043080145 8:75755910-75755932 GGGAAGAGTGGGAAGGACTTTGG + Intergenic
1045294295 8:100860377-100860399 GGGAACTGACGGCCTGACTCCGG - Intergenic
1046456346 8:114469147-114469169 GAGAAGAGTCAGCTTGACTTTGG - Intergenic
1046690842 8:117282719-117282741 AGGAAGAGACCACCTGACTTTGG + Intergenic
1047029073 8:120856983-120857005 GAAAAGAGTAGGCCTGACCTGGG + Intergenic
1047310926 8:123691182-123691204 GGCATGAGTCGTCCTGGCTTAGG - Intronic
1047724147 8:127669839-127669861 GGGAAGACTGTGCCTGACTGTGG - Intergenic
1047913672 8:129558759-129558781 AGGAAGAGTTAGCCTGACCTTGG - Intergenic
1048512023 8:135071717-135071739 AGGAGGAGATGGCCTGACTTTGG + Intergenic
1048512027 8:135071739-135071761 GGGAAGAGACAACCTGACTTTGG + Intergenic
1049730306 8:144173992-144174014 GCGAAGAGACAGCCTGACTTTGG - Intronic
1049843785 8:144790088-144790110 GGAAAGAGTCAGCCTGACTGGGG - Intronic
1049844461 8:144793183-144793205 GGAAAGAGTCAGCCCGACTGGGG + Intergenic
1049854043 8:144850585-144850607 GGGAAGAGTCAGCTGCACTTTGG + Exonic
1050237535 9:3597618-3597640 GGGAAGAGACAACCTGATTTCGG + Intergenic
1050792818 9:9495591-9495613 GGGAAGAGACGACCTGACTTAGG + Intronic
1050939697 9:11443268-11443290 AGGAGGAGATGGCCTGACTTCGG + Intergenic
1050939701 9:11443290-11443312 GGGAAGAGACAGCATAACTTTGG + Intergenic
1051507957 9:17846180-17846202 GGGAAGAGTCTTCCAGACATAGG - Intergenic
1052122148 9:24730954-24730976 GAGAAGAGACGGCTTAACTTGGG - Intergenic
1055135509 9:72824545-72824567 GAGAAGAGACAACCTGACTTTGG - Intronic
1055135511 9:72824567-72824589 GGGAAGAGTCGGCCTGACTTTGG - Intronic
1055135516 9:72824589-72824611 GGGGAGAGACGGCCTGACTTTGG - Intronic
1055152330 9:73017180-73017202 TGGAAGAGATGACCTGACTTCGG + Intronic
1059403227 9:114083761-114083783 GGGAGAAATAGGCCTGACTTCGG - Intergenic
1061283662 9:129610687-129610709 GGGCAGTGTTGGCCTGGCTTTGG - Intronic
1062232818 9:135491620-135491642 GGGATGAGTCAGCCTGATGTCGG + Intergenic
1188188354 X:27144515-27144537 GGCCAGAGACGGCCAGACTTTGG + Intergenic
1188495484 X:30779376-30779398 AGGAGGAGACAGCCTGACTTTGG + Intergenic
1189069268 X:37847209-37847231 GGGAGGACGAGGCCTGACTTGGG - Intronic
1189358179 X:40327314-40327336 GGGTAGCCTCAGCCTGACTTGGG + Intergenic
1193485457 X:82080764-82080786 GGGAAGAGACAACCTGACTTTGG - Intergenic
1198454592 X:136803915-136803937 GGGAAGAGACCTCCTGACTTCGG - Intergenic
1198637165 X:138712486-138712508 GGAAGGAGGCTGCCTGACTTTGG - Intronic