ID: 1055136686

View in Genome Browser
Species Human (GRCh38)
Location 9:72837274-72837296
Sequence ACACCTGAGCCGGAGATCTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055136686_1055136689 -8 Left 1055136686 9:72837274-72837296 CCTAAGATCTCCGGCTCAGGTGT No data
Right 1055136689 9:72837289-72837311 TCAGGTGTTTTCTATCTATTGGG 0: 55
1: 147
2: 179
3: 146
4: 323
1055136686_1055136688 -9 Left 1055136686 9:72837274-72837296 CCTAAGATCTCCGGCTCAGGTGT No data
Right 1055136688 9:72837288-72837310 CTCAGGTGTTTTCTATCTATTGG 0: 4
1: 46
2: 126
3: 166
4: 289
1055136686_1055136690 15 Left 1055136686 9:72837274-72837296 CCTAAGATCTCCGGCTCAGGTGT No data
Right 1055136690 9:72837312-72837334 AGACTGTCTTTCCCTAGCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055136686 Original CRISPR ACACCTGAGCCGGAGATCTT AGG (reversed) Intergenic
No off target data available for this crispr