ID: 1055142284

View in Genome Browser
Species Human (GRCh38)
Location 9:72889235-72889257
Sequence TATCCTACCCCCAGGCGGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055142284_1055142289 23 Left 1055142284 9:72889235-72889257 CCTTTCCGCCTGGGGGTAGGATA No data
Right 1055142289 9:72889281-72889303 ATATGCAAAGGTGCCTAGATTGG No data
1055142284_1055142288 11 Left 1055142284 9:72889235-72889257 CCTTTCCGCCTGGGGGTAGGATA No data
Right 1055142288 9:72889269-72889291 TCAGTTTCAGTTATATGCAAAGG No data
1055142284_1055142290 28 Left 1055142284 9:72889235-72889257 CCTTTCCGCCTGGGGGTAGGATA No data
Right 1055142290 9:72889286-72889308 CAAAGGTGCCTAGATTGGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055142284 Original CRISPR TATCCTACCCCCAGGCGGAA AGG (reversed) Intergenic
No off target data available for this crispr