ID: 1055142531

View in Genome Browser
Species Human (GRCh38)
Location 9:72892224-72892246
Sequence TCCTGCTGAATGAAAGGTCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055142531_1055142541 6 Left 1055142531 9:72892224-72892246 CCATGACCTTTCATTCAGCAGGA No data
Right 1055142541 9:72892253-72892275 CTGGAGTGCTGCTGAGGGCTGGG No data
1055142531_1055142537 0 Left 1055142531 9:72892224-72892246 CCATGACCTTTCATTCAGCAGGA No data
Right 1055142537 9:72892247-72892269 AGGGGCCTGGAGTGCTGCTGAGG No data
1055142531_1055142538 1 Left 1055142531 9:72892224-72892246 CCATGACCTTTCATTCAGCAGGA No data
Right 1055142538 9:72892248-72892270 GGGGCCTGGAGTGCTGCTGAGGG No data
1055142531_1055142542 7 Left 1055142531 9:72892224-72892246 CCATGACCTTTCATTCAGCAGGA No data
Right 1055142542 9:72892254-72892276 TGGAGTGCTGCTGAGGGCTGGGG No data
1055142531_1055142540 5 Left 1055142531 9:72892224-72892246 CCATGACCTTTCATTCAGCAGGA No data
Right 1055142540 9:72892252-72892274 CCTGGAGTGCTGCTGAGGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055142531 Original CRISPR TCCTGCTGAATGAAAGGTCA TGG (reversed) Intergenic
No off target data available for this crispr