ID: 1055142540

View in Genome Browser
Species Human (GRCh38)
Location 9:72892252-72892274
Sequence CCTGGAGTGCTGCTGAGGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055142531_1055142540 5 Left 1055142531 9:72892224-72892246 CCATGACCTTTCATTCAGCAGGA No data
Right 1055142540 9:72892252-72892274 CCTGGAGTGCTGCTGAGGGCTGG No data
1055142535_1055142540 -1 Left 1055142535 9:72892230-72892252 CCTTTCATTCAGCAGGAAGGGGC No data
Right 1055142540 9:72892252-72892274 CCTGGAGTGCTGCTGAGGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055142540 Original CRISPR CCTGGAGTGCTGCTGAGGGC TGG Intergenic
No off target data available for this crispr