ID: 1055152334

View in Genome Browser
Species Human (GRCh38)
Location 9:73017192-73017214
Sequence GGTCATCTTCCCCCGAAGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 370
Summary {0: 2, 1: 3, 2: 37, 3: 98, 4: 230}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055152334 Original CRISPR GGTCATCTTCCCCCGAAGTC AGG (reversed) Intronic
902142341 1:14367288-14367310 GGTATTCTTCCCCTGAAGTCCGG + Intergenic
903601672 1:24546523-24546545 GGTGGTCTTCCCCTGAAGTCTGG - Intergenic
909717597 1:78728198-78728220 GGTAATCTTCCCCCAGAGTCCGG - Intergenic
910321860 1:85955233-85955255 GGTGGTCTTCCCCTGGAGTCAGG - Intronic
911831413 1:102554787-102554809 GGTGATCTTCCCCTGGAGTCTGG - Intergenic
912582083 1:110729940-110729962 GGTATTCTTACCCTGAAGTCTGG - Intergenic
914331056 1:146671237-146671259 GGTGATCTTCCCCTGAAGTCCGG + Intergenic
916167721 1:161978521-161978543 GGTGGTCTTCCCCTGGAGTCGGG + Intergenic
917895619 1:179484397-179484419 GGTGATCTTGCCCCTAAGACAGG + Intronic
919240844 1:194914330-194914352 GGTGATCTTCTCCTGGAGTCTGG - Intergenic
920756458 1:208738416-208738438 GGTGATTTTCCCCTGGAGTCAGG + Intergenic
921680012 1:218020407-218020429 GGTAATCTTCCCCTAAAGTCTGG - Intergenic
922076871 1:222253779-222253801 GGTAATCTTCCCCTGGTGTCTGG - Intergenic
923291836 1:232553185-232553207 GATCATCTTCCCCTGGAGTTTGG + Intronic
923397791 1:233584162-233584184 GGTGATCTTCCCCCAGAGTCCGG - Intergenic
923701119 1:236301369-236301391 GGTAATCTTCCCCCAGAGTCTGG - Intergenic
923892836 1:238235030-238235052 GGTAATCTTCCCCTGAAGTCCGG + Intergenic
923944279 1:238865015-238865037 GGTAATCTTCCTCTGAAGTCCGG + Intergenic
924775681 1:247113242-247113264 GGTGATCTCACCCCGAAGGCAGG - Intergenic
924804703 1:247353005-247353027 GGTAATCTTCCCTTGAAGTCTGG - Intergenic
1064927167 10:20582031-20582053 GGAAATCTTTCCCTGAAGTCTGG - Intergenic
1065828295 10:29591856-29591878 GCTCATCTTCCTCCTAAGCCAGG - Intronic
1066272530 10:33837509-33837531 GGTGATCTTTCCCTGAAGCCTGG - Intergenic
1067453583 10:46397597-46397619 GGGCATCTTCCACGGAATTCTGG + Intergenic
1067583647 10:47462149-47462171 GGGCATCTTCCACGGAATTCTGG - Intronic
1067633650 10:47987497-47987519 GGGCATCTTCCACGGAATTCTGG - Intergenic
1068178093 10:53487565-53487587 GATTACCTTCCCCTGAAGTCAGG + Intergenic
1068321713 10:55426798-55426820 GCTAATCTTCCCCTGAAGTCCGG + Intronic
1069125620 10:64628902-64628924 GGTCATCTTCCCCTGGAGACTGG - Intergenic
1070177266 10:73981831-73981853 AGCCATTTTCCCCAGAAGTCTGG - Intergenic
1070470593 10:76775407-76775429 GGTAATCTTCCCCTGGAGTTTGG + Intergenic
1070758173 10:79006333-79006355 GGTCTTCTGGCACCGAAGTCTGG + Intergenic
1070905566 10:80070003-80070025 GGTGATCTTTCCCTGAAGCCTGG - Intergenic
1071152596 10:82652441-82652463 GATAATCTTCCCCTGAAGACTGG + Intronic
1071201487 10:83223807-83223829 GGTAATCTTCCCCTGAAGTCCGG + Intergenic
1074177949 10:111030006-111030028 GGTCGTCTTCCCCTGGAGTCGGG + Intergenic
1076430488 10:130398592-130398614 GGTGGTCTTCCCCTGGAGTCAGG + Intergenic
1078736361 11:14024456-14024478 GGTGGTCTTCCCCTGGAGTCAGG + Intronic
1078748467 11:14137750-14137772 GGTCACCTGCCCCTGAAGCCAGG + Intronic
1081075468 11:38667844-38667866 GGTCGTCTCCCCCTGGAGTCGGG + Intergenic
1081232876 11:40607578-40607600 GGTGATCTTTCCCTGGAGTCCGG - Intronic
1081332947 11:41826545-41826567 GACGATCTTTCCCCGAAGTCTGG + Intergenic
1081334059 11:41842532-41842554 GGTTATCTTCCCCTCAAGTCTGG - Intergenic
1083102685 11:60326479-60326501 GGTAATCTTCCCCTGGAATCTGG + Intergenic
1084568187 11:69943530-69943552 GGTCAGCTTCCCCAGGAGGCAGG - Intergenic
1084875015 11:72124664-72124686 AGTCATCTTCCCCCGAAGTCAGG + Intronic
1087396623 11:97609176-97609198 GGTGGTCTTCCCCTGGAGTCAGG + Intergenic
1087608424 11:100405424-100405446 GGTATTCTTCCCCTGAATTCTGG + Intergenic
1087879743 11:103402238-103402260 GGTCAACGTCCCCCTAATTCTGG + Intronic
1087981110 11:104615845-104615867 GGTGATCTTCCCCTGAAGTAGGG + Intergenic
1091252581 11:134156083-134156105 TCTCATCTTCCCCTGCAGTCAGG + Intronic
1091734081 12:2904875-2904897 GATCATCTTTACCTGAAGTCAGG + Intronic
1092680078 12:10969143-10969165 GGTAATCTTCCCCTGAAGTCCGG + Intronic
1093268493 12:17028228-17028250 GGTAATCTTCCCCTGAAGTCAGG - Intergenic
1093767574 12:22982489-22982511 AGTAGTCTTCCCCTGAAGTCTGG - Intergenic
1094191814 12:27705842-27705864 GTTCATCTTCCCCTGAGGTCAGG + Intergenic
1094596776 12:31873286-31873308 GGTGATCTTCCCCTGGAGTCAGG + Intergenic
1097170810 12:57111538-57111560 GGTCAGCCTCCCCCCAAGCCTGG - Intronic
1099543850 12:83951019-83951041 GGTAATCTTTCCCTGAAGTCTGG - Intergenic
1100206366 12:92354381-92354403 GGTGGTCTTCCCCTGGAGTCAGG - Intergenic
1100478114 12:94952706-94952728 GATCATCTTCCCCTGGAGTTTGG - Intronic
1102609572 12:114099593-114099615 GGTAATCTTCCCCTGGAGTCTGG + Intergenic
1103166257 12:118773119-118773141 GGTGATCTTCCCCTGGAGTCGGG + Intergenic
1104143136 12:126007187-126007209 GGTGATCTTTCCCTGAAGTCTGG + Intergenic
1104285144 12:127418220-127418242 TGTAATCTTCCCCCAAAGCCTGG - Intergenic
1106429311 13:29665279-29665301 GGCCATCTTGCCCAGGAGTCTGG - Intergenic
1106870234 13:34011466-34011488 GGTAATCTTCCTCTGAAGTCCGG - Intergenic
1107294387 13:38894286-38894308 GGTGATCTTTCCCTGAAGCCTGG - Intergenic
1107854039 13:44597338-44597360 GGTGATCTTCCCCTGGAGTCTGG + Intergenic
1108248597 13:48542420-48542442 GGTAATCTTCCCCTGAAGTCTGG - Intergenic
1108316550 13:49242656-49242678 GGTAATCTTCCCCTGAAGTCCGG - Intergenic
1108868939 13:54958642-54958664 GGTGATCTTCCCCTGGAGTCCGG - Intergenic
1109653975 13:65366078-65366100 GATGATCTTCCCCTGGAGTCAGG - Intergenic
1109685362 13:65812837-65812859 GGCCATCTTCCTCTAAAGTCAGG - Intergenic
1109793423 13:67279075-67279097 GGTAATCTTCCCCTGGGGTCCGG - Intergenic
1110159001 13:72352850-72352872 AGTAATCTTCCCCTGAAGTGTGG + Intergenic
1110385584 13:74906869-74906891 GGTGATCTTCCCATGGAGTCGGG + Intergenic
1110964523 13:81676182-81676204 GGTGGTCTTCCCCTGGAGTCGGG + Intergenic
1111184853 13:84720391-84720413 GGTGGTCTTCCCCTGGAGTCTGG - Intergenic
1111558384 13:89910900-89910922 GGTCATTTTCCCCCATAGTCAGG + Intergenic
1112547174 13:100382258-100382280 GGTGATCTTCCCCTGAAGTCCGG + Intronic
1112920302 13:104604262-104604284 GGTGGTCTTCCCCTGGAGTCAGG - Intergenic
1112929233 13:104713992-104714014 GGTGGTCTTCCCCTGGAGTCCGG - Intergenic
1113629910 13:111875102-111875124 TTTCATCTTCCCCCGCACTCTGG - Intergenic
1114643729 14:24242018-24242040 GGTCAGCTTGCCCCGAAGTGGGG - Intronic
1115153726 14:30314922-30314944 GGTAATCTTCCCCTGAAGTCTGG - Intergenic
1116090074 14:40293764-40293786 GGTGGTCTTCCCCTAAAGTCGGG + Intergenic
1116396435 14:44452720-44452742 GGTAATCTTCCTCTGGAGTCTGG + Intergenic
1118781541 14:69011877-69011899 GCCCATCTTCCCCAGAAGCCAGG + Intergenic
1119252468 14:73168606-73168628 GGTGATCTTTCCCTGAAGCCAGG - Intronic
1119876760 14:78066421-78066443 TGGCATCCTCCCCCCAAGTCAGG + Intergenic
1120474485 14:84969924-84969946 GATAATCTTCCCCTGGAGTCCGG + Intergenic
1120493382 14:85204551-85204573 GGTAATCTTCCCCTGAAGTCTGG - Intergenic
1121145595 14:91579435-91579457 GGTGATCTTCCCCTGGAGTCTGG - Intergenic
1122449512 14:101793860-101793882 GGTAATCTTCCCCTGAAGTCTGG + Intronic
1123809079 15:23905279-23905301 GGTGGTTTTCCCCTGAAGTCGGG + Intergenic
1123873592 15:24600829-24600851 GGTAATCTTCCCCTGAAGGCTGG - Intergenic
1125114115 15:36067956-36067978 GCTCATCTGCGCCCAAAGTCTGG + Intergenic
1125446893 15:39767764-39767786 GGTGGTCTTCCCCTGGAGTCAGG - Intronic
1126212097 15:46111447-46111469 GGTAATCTTCCCCTGAAGTCTGG - Intergenic
1126333837 15:47564942-47564964 GGTAATCTTCTCCTGAAGTCTGG - Intronic
1129305344 15:74656937-74656959 GGTAATTTTCCCCTTAAGTCTGG - Intronic
1130430432 15:83842000-83842022 GGTGGTCTTCCCCTGGAGTCGGG - Intronic
1131814800 15:96211335-96211357 GGTGAACTTCCCCTGGAGTCTGG - Intergenic
1131931604 15:97448885-97448907 GATAATCTTCCCCCAGAGTCTGG - Intergenic
1133313468 16:4867003-4867025 GGGCATCTTCCCCAGGAGGCCGG - Intronic
1133695644 16:8260029-8260051 GGTGATCTTTCCCTGAAGCCTGG - Intergenic
1133978664 16:10618022-10618044 GGGCATCTCTCCCCAAAGTCAGG - Intergenic
1134239665 16:12496262-12496284 GGTCACATTCCACCCAAGTCAGG + Intronic
1138265004 16:55654296-55654318 TGTCATCTTCCCCAGAAGCCAGG + Intergenic
1139017843 16:62711653-62711675 GGTGGTCTTCCCCTGGAGTCAGG - Intergenic
1140002497 16:71039667-71039689 GGTGATCTTCCCCTGAAGTCCGG - Intronic
1140339116 16:74139821-74139843 GATGATCTTCCCCTGGAGTCTGG + Intergenic
1140748147 16:77999177-77999199 GGTGATCTTCCCCGGGAGTCAGG + Intergenic
1142301762 16:89262749-89262771 GGTAATCTTCCCCTGAAGTCTGG + Intergenic
1146420095 17:32676661-32676683 GGTCGTCTTCCTTCTAAGTCTGG - Intronic
1146549574 17:33768871-33768893 AGTCGTCTTCCCCCAAAGTCAGG - Intronic
1146885737 17:36469623-36469645 AGTGATCCTCCCCTGAAGTCCGG + Intergenic
1147230777 17:39016238-39016260 GGTGATCTTTCCCTGAAGCCTGG + Intergenic
1147554256 17:41466297-41466319 GGTCCTCTTCCCTGGAACTCTGG + Intronic
1149237275 17:54607177-54607199 GGTAATCTTCCAATGAAGTCTGG - Intergenic
1150686455 17:67325075-67325097 GGTAGTCTTCCCCTGAAATCCGG - Intergenic
1150999018 17:70352106-70352128 GGTCGTCTTCCCCTGGAGTCGGG - Intergenic
1151533204 17:74720922-74720944 GGTGATCTTTCCCTGAAGCCTGG + Intronic
1152227216 17:79098020-79098042 GGGCGTCATCCCCCGAAGCCTGG + Intronic
1155017877 18:21863498-21863520 GGTAATCTTCCCCTGAAGTCCGG + Intronic
1155797840 18:30062473-30062495 GGTCATCTTCCCCCTAATATTGG + Intergenic
1155807104 18:30185117-30185139 GGTAATCTTCTCCTGAAGGCTGG - Intergenic
1156400647 18:36736539-36736561 AGTAATCTTCCCCCAGAGTCTGG + Intronic
1156713519 18:39977382-39977404 GATAATCTTCCCCTGAATTCTGG + Intergenic
1157855394 18:51100439-51100461 GGTGGTCTTCCCCTGGAGTCGGG - Intergenic
1158014392 18:52766574-52766596 GGTAATCTTCCCTTGAAGTCTGG + Intronic
1158188301 18:54796528-54796550 GGTGGTCTTCCCCTGGAGTCAGG + Intronic
1158245059 18:55423062-55423084 TTTCAACTTCCCCCAAAGTCCGG - Intronic
1158526631 18:58220532-58220554 GTTCATCTTCCCCCCACCTCTGG + Intronic
1158856113 18:61544544-61544566 GGTGATCTTCCCCCGGATTCGGG + Intronic
1158968538 18:62644640-62644662 GGTAATCTTCCCCTGAAGTCTGG - Intergenic
1159777509 18:72620420-72620442 GGTAATCTTCCCCTCAAGTCTGG + Intronic
1162074305 19:8174904-8174926 GGTCATCTTTTTCTGAAGTCAGG - Intronic
1164143687 19:22496255-22496277 GATAATCTTCCCCTGAAGTTTGG - Intronic
1165300851 19:34967817-34967839 GGTAATCGTCCCCTGAAGTTTGG - Intergenic
1166907289 19:46120153-46120175 GGCATTCTTCCCCTGAAGTCTGG + Exonic
925367656 2:3322033-3322055 GGACATCTTCCCGTGAAGTGAGG - Intronic
926468903 2:13228056-13228078 GGTGATCTTTCCCTGAAGCCCGG + Intergenic
926961692 2:18364651-18364673 GGTGGTCTTCCCCTGGAGTCGGG + Intergenic
926961700 2:18364673-18364695 GGTGGTCTTCCCCTGGAGTCGGG + Intergenic
927713264 2:25338730-25338752 GGGCATCTTCCCCCGAGTGCAGG + Intronic
928103914 2:28455329-28455351 GGTGATCTTCCCCTGGAGTCAGG - Intergenic
928591298 2:32818149-32818171 TGTCATTTTCCCCCAAAGTGTGG + Intronic
928813102 2:35253610-35253632 GGTGATCTTCCCCCAGAGTCTGG - Intergenic
929886019 2:45879269-45879291 GGTATTCTTCCCCTGAAGTCTGG - Intronic
930515428 2:52401752-52401774 GGTAATCTTCCCCTGAAGTCTGG - Intergenic
930575565 2:53142655-53142677 GGTGATCTTCCCCTGTAGTCTGG - Intergenic
931025258 2:58106301-58106323 GGGAATTTTCCCCAGAAGTCTGG + Intronic
931458664 2:62432157-62432179 GGTAATCTTCCCCCGGAGTCTGG - Intergenic
931462940 2:62463965-62463987 GGTCATCTTCTTCTGAAGTCTGG - Intergenic
931938942 2:67230860-67230882 GGTAATCTTCCCCTGAAGTCTGG - Intergenic
936886036 2:117310771-117310793 GGTGATGTTCCCCTGGAGTCAGG + Intergenic
937201187 2:120205494-120205516 GGTCACCCTGCCCCGAAGTCTGG + Intergenic
937571901 2:123373585-123373607 GATCATCTTCCACCTATGTCAGG + Intergenic
938089566 2:128422407-128422429 GGTCATCTTCTCCCAAAGTCAGG + Intergenic
938787773 2:134648172-134648194 GATAATCTTCCCCCAGAGTCTGG + Intronic
938942473 2:136181158-136181180 GGTAATCTTCCCTTGGAGTCTGG + Intergenic
941427598 2:165368165-165368187 GGTAATCTTCCCCTGGAGTCTGG + Intronic
941451710 2:165667852-165667874 GGTCATCTCCCCCAGCAGACTGG + Intronic
941996414 2:171605722-171605744 GATAATCTTCCCCTGAAGTTTGG + Intergenic
942983168 2:182106494-182106516 GGTGATCTTCCCCTGGAGTCAGG - Intronic
943382593 2:187170503-187170525 GGTAATCTTCCCTTGAAGTCTGG + Intergenic
944001378 2:194842644-194842666 GGTAATCTTCCCCTGAAATCCGG - Intergenic
944067410 2:195633691-195633713 AGTATTCTTCCCCTGAAGTCCGG + Intronic
944891073 2:204117866-204117888 GGTGGTCTTCCCCTGGAGTCTGG + Intergenic
946210476 2:218143566-218143588 GGTGGTCTTCCCCTGGAGTCAGG + Intergenic
946832539 2:223741098-223741120 GGTGGTCTTCCCCTGGAGTCAGG + Intergenic
946907415 2:224430092-224430114 GGTCATCTTCTCCCGAAGTCAGG - Intergenic
947596831 2:231418282-231418304 GGTAATCTTCCCCTGAAGTCCGG - Intergenic
948008253 2:234629032-234629054 GGTGATCTTCCCCTGGAGTTTGG - Intergenic
1170105457 20:12750520-12750542 GGTGATCTTCCTCTGAAGCCCGG - Intergenic
1170290512 20:14763825-14763847 TGTGATCTTTCCCCCAAGTCCGG - Intronic
1170446591 20:16434293-16434315 GGTCTTCTTCCCACGAGATCTGG - Intronic
1177281420 21:18987256-18987278 GGTAACCCTCCCCGGAAGTCTGG - Intergenic
1177640132 21:23834833-23834855 GCTAATCTTCCCCTGAAGTCTGG - Intergenic
1178178270 21:30129752-30129774 GGTGATCTTTCCCCGAAGCCTGG + Intergenic
1184335350 22:43849590-43849612 GGTTATCTTCCCCTGGAGTCTGG - Intronic
949444127 3:4115223-4115245 GGTGATCTTCCCCTGGAGACTGG - Intronic
949631208 3:5928885-5928907 GGTCGTCTTCCCCTGGAGTCTGG - Intergenic
949956658 3:9274763-9274785 GGTAATCTTCCCCTGAAATCTGG + Intronic
950978916 3:17280614-17280636 GATGATCTTCCCCTGGAGTCCGG - Intronic
951637778 3:24798618-24798640 GGTGATCTTCCCCTGGAGTTGGG - Intergenic
952107742 3:30088838-30088860 GGTTGTCTTCCCCTGGAGTCTGG + Intergenic
952181448 3:30920696-30920718 GGTAATTTTCCCCCAAAGTCTGG - Intergenic
952203853 3:31159257-31159279 TGTCATTTTCCTCCTAAGTCTGG - Intergenic
954279249 3:49564309-49564331 GGGCATCTTCACACGAAGTCTGG + Intronic
957029281 3:75221427-75221449 GGTGGTCTTTCCCTGAAGTCAGG + Intergenic
958023680 3:88026299-88026321 GGTGATCTTCCCCTGGAGTTTGG + Intergenic
958119291 3:89263550-89263572 GGTAATCTTCCCCTGAAGTCTGG + Intronic
958529540 3:95309191-95309213 GGTAATCTTCTCCTGATGTCTGG - Intergenic
958978804 3:100697029-100697051 GGTGATCTTCCCCTGGAGTCTGG - Intergenic
963410573 3:144922110-144922132 AGTAATCTTCCCCTGAAGTCTGG + Intergenic
963534849 3:146514560-146514582 GGTGATCTTCCCCTGAAGTCTGG - Intergenic
965067123 3:163864303-163864325 GGTCATCTTCCCCTGAGGTCTGG - Intergenic
966033298 3:175377854-175377876 GGTAATCTTCCCCTGAAGTCCGG - Intronic
967761236 3:193228379-193228401 GGTGATCTTTCCCTGGAGTCAGG - Intergenic
969587550 4:8103181-8103203 TGTCATCTTAACACGAAGTCTGG - Intronic
971005473 4:22369971-22369993 GATAATCTTCCCCTGAAGTCTGG - Intronic
971335598 4:25720941-25720963 GGTCAGCGTCCCCCTAATTCTGG + Intergenic
971730284 4:30370345-30370367 GGTGATCTTCCCCTGAATCCTGG - Intergenic
972108579 4:35525681-35525703 GGTGGTCTTCCCCTGGAGTCTGG + Intergenic
972390258 4:38607041-38607063 GGTGGTCTTCCCCTGGAGTCGGG + Intergenic
974166845 4:58214923-58214945 GGTGGTCTTCCCCTGGAGTCAGG + Intergenic
974962844 4:68725048-68725070 GGTGGTCTTCCCCTGCAGTCGGG + Intergenic
975002952 4:69247980-69248002 TATCATCTTCCCCTGAACTCTGG - Intergenic
975830397 4:78362790-78362812 GGTCGTCTTTCCCCAAAATCAGG + Intronic
975947384 4:79724038-79724060 GGTAATCTTCCCCTGAAATCCGG + Intergenic
976031360 4:80758272-80758294 GGTAATCTTCTCCTGGAGTCTGG + Intronic
976042036 4:80898295-80898317 GGCAATCCTCCCCCAAAGTCTGG + Intronic
976859067 4:89640961-89640983 GGTAATTTTCCCCTGAAATCCGG - Intergenic
976890397 4:90039680-90039702 GGTGGTCTTCCCCTGCAGTCAGG + Intergenic
977019353 4:91740652-91740674 GGTAGTCTTCCTCTGAAGTCCGG - Intergenic
977338709 4:95730143-95730165 GGTAATCTTCCCCTGGAGTCTGG + Intergenic
977357843 4:95969292-95969314 GGTAGTCTTCCCCTGAAGTTTGG - Intergenic
977364953 4:96056294-96056316 GGTAATCTTCCCCTGAAGTCCGG - Intergenic
979156637 4:117401012-117401034 GGTCATTTTGCCCTGAAATCTGG - Intergenic
979189234 4:117835681-117835703 GGTGGTCTTCCCCTGGAGTCGGG + Intergenic
979297991 4:119054519-119054541 GGTTGTCTTCCCCTGAAGTCAGG + Intronic
979725517 4:123956083-123956105 GGTCATCTTCCCCTGAAGTCAGG - Intergenic
979802413 4:124927255-124927277 GGTGGTCTTCCCCTGGAGTCGGG + Intergenic
980438293 4:132809508-132809530 GGTGATCTTCCCCTGGAGTCGGG - Intergenic
981297303 4:143146904-143146926 GGTAATCTTCCCCTGGAGTCTGG - Intergenic
982326793 4:154136880-154136902 GGTAATCTTCCCCTGGAGTCAGG + Intergenic
982671056 4:158320459-158320481 GGTATTCTTCCCCTGAAGTCTGG + Intronic
982774436 4:159427530-159427552 GGTGATCTTCCCCTGGAGTCAGG - Intergenic
982786628 4:159544114-159544136 GGTAATTTTCTCCTGAAGTCTGG + Intergenic
982861990 4:160463831-160463853 GGTAATCTTTCCCTGAAGTCTGG + Intergenic
983774132 4:171584744-171584766 GGTGGTCCTCCACCGAAGTCAGG + Intergenic
983810201 4:172051504-172051526 GGTGATCTTCCCCTGCAGTTTGG + Intronic
984105560 4:175541206-175541228 GGTCACTCTCCCCTGAAGTCAGG + Intergenic
985138312 4:186812075-186812097 GGTGATCTTCCCCTGGAGTTTGG + Intergenic
985752937 5:1692748-1692770 GGTGATCTTCCCCTGGAGGCTGG + Intergenic
986159965 5:5218755-5218777 GGTGGTCTTCCCCTGGAGTCAGG + Intronic
986163194 5:5249917-5249939 GATAATCTTCCCCTGGAGTCTGG + Intronic
986588693 5:9346250-9346272 GGTTATCTTCCCCTGGAGTCCGG - Intronic
986935292 5:12876872-12876894 GGTATTCTTCCCCTGATGTCTGG - Intergenic
988414618 5:30930446-30930468 GGGCATCTTGACCCGAAGACTGG - Intergenic
988635391 5:32978099-32978121 GATAATCTTCCCCTGGAGTCTGG - Intergenic
989541924 5:42628006-42628028 GGTGAACTTCCTCTGAAGTCGGG + Intronic
990128402 5:52548291-52548313 GGTGATCTTCCCATGAAGTTTGG - Intergenic
990293457 5:54378487-54378509 GGTAATCTTTCCCCAGAGTCTGG - Intergenic
990376902 5:55179613-55179635 GTTACTCTTCCCCAGAAGTCTGG + Intergenic
991667106 5:69010270-69010292 GGTCATGTTCTCCCCAAGACTGG + Intergenic
993188097 5:84645909-84645931 GGTGGTCTTCCCCTGGAGTCAGG - Intergenic
993274874 5:85844086-85844108 GGTAATCTTCCCTTGAAGTCTGG + Intergenic
993293206 5:86101888-86101910 GGTTGACTTCCCCCGAAGTCCGG - Intergenic
993297032 5:86153615-86153637 GGTAATCCTCCCCTGAATTCTGG + Intergenic
995533639 5:113114756-113114778 GGTAATCTTCCCCTGGATTCTGG - Intronic
996294100 5:121890873-121890895 GGTCGTCTTTCCCCGAAGTCAGG + Intergenic
996852295 5:127966549-127966571 GGTGATCTTCCCCTGGAGTTGGG + Intergenic
998856383 5:146398863-146398885 AGTCATCTTCCCCTGAAGTCGGG - Intergenic
999840048 5:155414824-155414846 TGTCATCTTGCCCTGAGGTCTGG - Intergenic
999924545 5:156360734-156360756 AGTCGTCTTCCCCCAAAGTCAGG - Intronic
1000470209 5:161631110-161631132 GGTGGTCTTCCCCTGGAGTCAGG + Intronic
1000810669 5:165857451-165857473 GGTAATCTTCCCCTGAAGTCTGG - Intergenic
1000866282 5:166518709-166518731 GGTAATCTTCCCCTGAAGTCTGG + Intergenic
1001973723 5:175979295-175979317 CGTTGTCTTCCCCTGAAGTCAGG - Intronic
1002243709 5:177864484-177864506 CGTTGTCTTCCCCTGAAGTCAGG + Intergenic
1002564124 5:180100422-180100444 GGTCATCTAGCCAGGAAGTCAGG - Intergenic
1005363377 6:25053703-25053725 GGTAATCTTCCCCTGAAGTCTGG + Intergenic
1007948217 6:45844851-45844873 GGTCAGCTTCCCCCAAAATCAGG - Intergenic
1009626009 6:66139500-66139522 GTTAATCTTTCCCTGAAGTCCGG + Intergenic
1010327534 6:74582103-74582125 GGTGATCTTCCCCTAAAGCCTGG + Intergenic
1010337664 6:74705534-74705556 GGGCATATCCACCCGAAGTCAGG - Intergenic
1010503797 6:76632128-76632150 GGTGGTCTTCCCCTGAGGTCCGG + Intergenic
1011233811 6:85193001-85193023 GGTATTCTTCCCCTGAAGTCTGG - Intergenic
1011907653 6:92392282-92392304 GGTGATCTTCCCCTGGAGTCAGG - Intergenic
1012263248 6:97111839-97111861 GGTAATCTTCCCCTGAAGTCTGG + Intronic
1012769043 6:103405314-103405336 GGAGATCTTCCCCTGAAGCCTGG + Intergenic
1012829316 6:104186069-104186091 GATAATCTTCCCCTGAGGTCTGG - Intergenic
1014325390 6:119986784-119986806 GGTGATCTTCCCCTGGAGTCAGG - Intergenic
1014867570 6:126550893-126550915 GGTGGTCTTCCCCTGGAGTCAGG + Intergenic
1015156720 6:130104554-130104576 GCTCTTCTTCCCCTGAAATCAGG + Exonic
1016084389 6:139894854-139894876 AGTAATCTTTCCCCAAAGTCTGG + Intergenic
1016183113 6:141171232-141171254 GGTAATCTTTCCCTGGAGTCCGG + Intergenic
1016548951 6:145255571-145255593 GGTAATCTTCCCCTGGAGTCCGG + Intergenic
1018278022 6:162153711-162153733 GGTCACTGTCCCCCGAAGTCAGG + Intronic
1018310502 6:162503378-162503400 GGTCATCAACCCCCGACCTCAGG + Intronic
1018620398 6:165725090-165725112 GGTGGTCTTCCCCTGGAGTCAGG - Intronic
1018654781 6:166024799-166024821 GGTCATCTTCCCCAAAAGTCAGG + Intergenic
1018831090 6:167444149-167444171 GGTTATCTTTCCCTGAAGCCCGG + Intergenic
1019030717 6:169008452-169008474 CATCATCTTCCCCCTAAGCCAGG + Intergenic
1019042308 6:169117436-169117458 GGTGATCTTCCCCTGGAGTCTGG - Intergenic
1019045674 6:169143509-169143531 GGCGATCTTCCCCTGGAGTCTGG + Intergenic
1019161689 6:170072683-170072705 GGATGTCTTCCCCCGAAGACTGG - Intergenic
1019245996 6:170710099-170710121 AGTCATCTTCCCAAGATGTCAGG + Intergenic
1019664162 7:2243048-2243070 GGTGATTTTCCCCTGGAGTCGGG + Exonic
1021210667 7:17848225-17848247 GGTAATCTTCCCCTGAAGTCCGG - Intronic
1021420356 7:20439827-20439849 GGTAATCTTTCCCTGAAGCCTGG - Intergenic
1021420739 7:20442582-20442604 GGTGATCTTTCCCTGAAGCCTGG - Intergenic
1021550662 7:21867964-21867986 GGGCATCTACCCCCGGAGACAGG - Exonic
1022562989 7:31369318-31369340 GGTAATCTTCCCCTGGAGTCCGG + Intergenic
1023932276 7:44713201-44713223 GCTCACCTTCCCCAGCAGTCTGG + Intergenic
1024612348 7:51078368-51078390 GGTCAGCTTCCCCCTAAGGCTGG - Intronic
1024808961 7:53184559-53184581 GGCAATCTTCCCCTGAAGTCCGG - Intergenic
1025849341 7:65233203-65233225 GATTATCTTCCCCTGAAGTCTGG - Intergenic
1026313919 7:69211653-69211675 GGTGATCTTCCCCTGGAGTTGGG - Intergenic
1027569548 7:79847206-79847228 GGTGATCTTCCCCTGGGGTCAGG - Intergenic
1028046852 7:86130899-86130921 GGTAATCTTCCCCTGAAGTCTGG + Intergenic
1028345779 7:89780116-89780138 GGTAAACTTCCCCTGAAGTCCGG - Intergenic
1030513616 7:110515513-110515535 GGTGGTCTTCCCCTGGAGTCGGG + Intergenic
1031063426 7:117077052-117077074 TGTAATCTTCCCCTGGAGTCTGG + Intronic
1032248382 7:130232148-130232170 GGTAATTTTCCCCTGGAGTCTGG + Intergenic
1032917594 7:136509889-136509911 GATAATCTTCCCCTGAAGTCTGG + Intergenic
1033857182 7:145577907-145577929 GGTGGTCTTCCCCTGGAGTCTGG + Intergenic
1033883500 7:145916560-145916582 AGTAATCTTCCCCTGAAGTCTGG - Intergenic
1034023439 7:147670644-147670666 GGTAATCTTCCCCTGACGTCTGG - Intronic
1035490528 7:159272604-159272626 GGTGATTTTCCCCTGGAGTCGGG - Intergenic
1035824399 8:2629114-2629136 GATAATCTTCCCCTGAAGTTTGG + Intergenic
1036101855 8:5795659-5795681 GGTGGTCTTCCCCTGGAGTCAGG - Intergenic
1036463957 8:8978986-8979008 GCTCATCTTCCCCTGGAGTTAGG - Intergenic
1037258537 8:16981880-16981902 GGTAATCTGCCCCTGAAGTCCGG - Intergenic
1037822678 8:22142439-22142461 GGTCAGCCTGCCCCGGAGTCAGG - Intergenic
1038285999 8:26206984-26207006 GGTCATCTTCCCCCGAAGTCGGG - Intergenic
1039075845 8:33689803-33689825 GGTGATCTTCCCCTGGAGTGGGG - Intergenic
1039661365 8:39470807-39470829 GATAATCTTCCCCTCAAGTCCGG - Intergenic
1040663684 8:49604872-49604894 GGTAATCTTCTCCTGAAGTCTGG - Intergenic
1040683482 8:49842194-49842216 GGTAATCTTCTCCTGAAGTCTGG - Intergenic
1042081575 8:65059880-65059902 GGTAATCTTCCCCTGAAGTCCGG - Intergenic
1042445911 8:68884912-68884934 GGTAATCTTCCCCTGAAGTACGG + Intergenic
1043599798 8:81923552-81923574 GGTAGTCTTCCCCTGGAGTCAGG - Intergenic
1044085347 8:87936459-87936481 GGTGATTTTCCCCTGGAGTCGGG + Intergenic
1044448176 8:92302444-92302466 GGTGATCTTCCCCTGGAGTTGGG + Intergenic
1044765802 8:95572578-95572600 GGTGATCCTCCCCTGGAGTCGGG - Intergenic
1046396823 8:113651115-113651137 GGTGATCTTTCCCTGAAGCCTGG - Intergenic
1047214415 8:122864894-122864916 GGTCTTCTTCCCCTGGGGTCTGG + Intronic
1048648704 8:136450976-136450998 GGTGATCTTCCCATGGAGTCAGG + Intergenic
1050330424 9:4540214-4540236 GATAATCTTCCCCCAGAGTCTGG - Intronic
1050819174 9:9856106-9856128 GGTAATCTTCACCTGAAGTCCGG + Intronic
1051983796 9:23057602-23057624 GATGATCTTCCCCTGGAGTCTGG - Intergenic
1052122141 9:24730891-24730913 GGTAATCTTCGCCTGAAGTCTGG + Intergenic
1052169686 9:25377688-25377710 GGTAATCTTCCCCTGGAATCTGG + Intergenic
1053545364 9:39017828-39017850 GGTAATCTTCCCCTGGAGTCTGG + Intergenic
1053809683 9:41839509-41839531 GGTAATCTTCCCCTGGAGTCTGG + Intergenic
1054620910 9:67347919-67347941 GGTAATCTTCCCCTGGAGTCTGG - Intergenic
1055152334 9:73017192-73017214 GGTCATCTTCCCCCGAAGTCAGG - Intronic
1055376127 9:75649448-75649470 GGTAGTCTTCCCCTGAAATCTGG + Intergenic
1055708472 9:79033702-79033724 GGTAATCTTCCCTTGCAGTCTGG + Intergenic
1056059553 9:82870194-82870216 GGTAATCTTCCTCTGAAGTCCGG - Intergenic
1057542800 9:95990964-95990986 GGTGATCTTTCCCTGAAGCCTGG + Intronic
1059795701 9:117694167-117694189 GCTCATATTCCCCCCAAATCAGG - Intergenic
1061182326 9:129032004-129032026 GGTAATCTTCCCCTGAAGCCTGG - Intergenic
1185975392 X:4714185-4714207 GGTGATCTTTCCCTGAAGCCTGG - Intergenic
1186047495 X:5552251-5552273 GATCATCTTCCCCCGCAGTTCGG - Intergenic
1187384296 X:18833312-18833334 GGTGATCTTTCCCTGAAGCCCGG - Intergenic
1187642749 X:21312825-21312847 GGTCATCCTACTCAGAAGTCTGG + Intergenic
1187707879 X:22025484-22025506 GGTGGTCTTCCCCTGGAGTCGGG + Intergenic
1188183773 X:27088709-27088731 GGGGATCTTCCCCTGGAGTCAGG + Intergenic
1188188359 X:27144527-27144549 GGTAATCTTCCCCCAAAGTCTGG - Intergenic
1189413110 X:40791248-40791270 GGTGGTCTTCCCCTGGAGTCAGG + Intergenic
1189415091 X:40805969-40805991 GGTGGTCTTCCCCTGGAGTCTGG + Intergenic
1190125151 X:47698286-47698308 GGTAATCTTCCCCCATAGTCTGG - Intergenic
1190167509 X:48085303-48085325 AGTATTCTTCCCCTGAAGTCTGG + Intergenic
1190631299 X:52389463-52389485 GGTGGTCTTCCCCTGGAGTCAGG + Intergenic
1193532648 X:82674841-82674863 GGTATTCTTCCCCTGAAGTCTGG + Intergenic
1194176212 X:90651435-90651457 GGCAATCCTCCCCTGAAGTCTGG + Intergenic
1194859554 X:98980001-98980023 GGTGGTCTTCCCCTGAAGTCAGG - Intergenic
1196869132 X:120096308-120096330 GGTGATTTTCCCCTGGAGTCAGG - Intergenic
1197241489 X:124127343-124127365 GGTGGTCTTCCCCTGGAGTCGGG - Intronic
1198613266 X:138425471-138425493 GGTAATCTTCCCATGGAGTCTGG - Intergenic
1198883402 X:141306497-141306519 GGTGGTCTTCCCCTGGAGTCAGG - Intergenic
1199069772 X:143462582-143462604 GATGATCTTCCCCTGGAGTCGGG - Intergenic
1199337051 X:146630463-146630485 GGTAATCTTCCCCTAGAGTCTGG - Intergenic
1200522838 Y:4232380-4232402 GGCAATCCTCCCCTGAAGTCTGG + Intergenic