ID: 1055152583

View in Genome Browser
Species Human (GRCh38)
Location 9:73020465-73020487
Sequence CTGAGTTAGGGGATGGTTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055152577_1055152583 1 Left 1055152577 9:73020441-73020463 CCAGAGAGAAAGCAATATCATCC 0: 1
1: 0
2: 0
3: 14
4: 158
Right 1055152583 9:73020465-73020487 CTGAGTTAGGGGATGGTTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055152583 Original CRISPR CTGAGTTAGGGGATGGTTGA AGG Intronic
No off target data available for this crispr