ID: 1055154709

View in Genome Browser
Species Human (GRCh38)
Location 9:73046144-73046166
Sequence ATGCTAAGAAGCAGAATTTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055154706_1055154709 -1 Left 1055154706 9:73046122-73046144 CCTCCTTTTGAAATACAACCTTA 0: 1
1: 0
2: 1
3: 13
4: 221
Right 1055154709 9:73046144-73046166 ATGCTAAGAAGCAGAATTTCTGG No data
1055154707_1055154709 -4 Left 1055154707 9:73046125-73046147 CCTTTTGAAATACAACCTTATGC 0: 1
1: 0
2: 0
3: 11
4: 154
Right 1055154709 9:73046144-73046166 ATGCTAAGAAGCAGAATTTCTGG No data
1055154705_1055154709 21 Left 1055154705 9:73046100-73046122 CCACTCTTGTACATGAATTTTGC 0: 1
1: 0
2: 0
3: 10
4: 162
Right 1055154709 9:73046144-73046166 ATGCTAAGAAGCAGAATTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055154709 Original CRISPR ATGCTAAGAAGCAGAATTTC TGG Intronic
No off target data available for this crispr