ID: 1055155083

View in Genome Browser
Species Human (GRCh38)
Location 9:73052924-73052946
Sequence TGACAGAGTTGACCATAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 125
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 117}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055155083_1055155084 4 Left 1055155083 9:73052924-73052946 CCTGCTTATGGTCAACTCTGTCA 0: 1
1: 0
2: 1
3: 6
4: 117
Right 1055155084 9:73052951-73052973 AATATTGAGATAATTTTCTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055155083 Original CRISPR TGACAGAGTTGACCATAAGC AGG (reversed) Intronic
902779396 1:18694680-18694702 TGACACAGCTGACCAAAGGCAGG - Intronic
905921894 1:41725153-41725175 TGAAACAGCTGACCCTAAGCAGG + Intronic
909438271 1:75669338-75669360 AGAGGGAGTAGACCATAAGCAGG - Intergenic
910086938 1:83414312-83414334 TGACAGACTTCTCCATTAGCAGG + Intergenic
910561246 1:88593979-88594001 TGACACAGTTGACAATAATAAGG - Intergenic
913496491 1:119432735-119432757 GGACAGAGTTGAACTGAAGCAGG + Intergenic
913505914 1:119516108-119516130 TGACAGAGTTGAACTGAAGTGGG + Intergenic
913509225 1:119547304-119547326 GGACAGAGTTGAACTGAAGCGGG + Intergenic
913512373 1:119573524-119573546 GGACAGAGTTGAACTGAAGCAGG + Intergenic
913516654 1:119611032-119611054 GGACAGAGTTGAACTGAAGCAGG + Intergenic
915170448 1:153973668-153973690 TTCCAGAGTCGACCAGAAGCTGG + Exonic
917788016 1:178480322-178480344 TGACAAAGCTGACCAGAAGATGG + Intergenic
918224948 1:182472722-182472744 AGACACAGTTGTCCTTAAGCTGG + Intronic
921901116 1:220451924-220451946 AGACAGAGTTGACAATCAGTTGG + Intergenic
922597282 1:226823755-226823777 TGACAGAGGGGACCAAAAGTAGG - Intergenic
922600871 1:226851956-226851978 TGACACAGGGGACCATATGCTGG - Intergenic
923827934 1:237520965-237520987 AGACAGAGTTTGCCATAAGCCGG + Intronic
1063507529 10:6614312-6614334 TGAGAGAGTGGAGCATCAGCAGG + Intergenic
1068437647 10:57013365-57013387 TGGCAGAGTTGTCAAGAAGCTGG - Intergenic
1071834029 10:89401507-89401529 TGACAGATGTGACCATAAAGGGG + Intronic
1072166063 10:92814203-92814225 AGGCAGTGTTAACCATAAGCTGG - Intergenic
1072450070 10:95532651-95532673 TGACAGAGATGAGAAGAAGCTGG + Intronic
1073916893 10:108415803-108415825 TCACTGAGTTGACTTTAAGCAGG + Intergenic
1076130634 10:128011511-128011533 TGCCAGAGGTGACCAGAAGGTGG - Intronic
1081804051 11:45880452-45880474 TGACTGAGTTTACAATCAGCAGG - Intronic
1083938624 11:65883262-65883284 GGACAGAGTGGTCCACAAGCTGG - Exonic
1085701754 11:78752056-78752078 TGACAGAGATGACCTAAAGTAGG - Intronic
1090998844 11:131891376-131891398 AGACAGGGTTGACCACAAGTTGG + Intronic
1092894282 12:12998064-12998086 TGACATAGTTGTGCATAGGCTGG - Intronic
1097143535 12:56923863-56923885 TGACAGATTTCATCCTAAGCCGG - Exonic
1100176749 12:92039296-92039318 TGACTGGTTTGACCACAAGCAGG + Intronic
1105861302 13:24417139-24417161 TGACAGTATTGACCATATTCTGG - Intergenic
1108786446 13:53908519-53908541 AGACAGAGGTGACCCTGAGCTGG + Intergenic
1109266116 13:60202287-60202309 TGACTGAGTTGACCATGAATTGG + Intergenic
1110535538 13:76646872-76646894 TGACACAGTTGACCTTAAAAAGG - Intergenic
1110898757 13:80792873-80792895 TGACAGACATTACCAGAAGCTGG - Intergenic
1113912309 13:113848681-113848703 TGGCATGGTTGACCCTAAGCTGG - Intronic
1115721950 14:36171840-36171862 TGACATAGATGACCATACCCAGG + Intergenic
1116640905 14:47461640-47461662 TTACAGAGTGAACCATAAGTAGG + Intronic
1121922020 14:97890786-97890808 TCACAGTGATGACCAGAAGCAGG - Intergenic
1125221881 15:37347254-37347276 TGACACAGCTGAATATAAGCAGG + Intergenic
1126312695 15:47335572-47335594 TCACAGAATTTACCATAATCTGG - Intronic
1128191387 15:65702384-65702406 TGACAGACTTTCACATAAGCTGG + Exonic
1128659072 15:69484688-69484710 TAGCAGAGTTCACCATCAGCAGG + Intergenic
1129660898 15:77552372-77552394 TGACAGACTTGACCTCCAGCAGG - Intergenic
1147173802 17:38638487-38638509 TAACAAAATTGACCATATGCTGG + Intergenic
1162259782 19:9523184-9523206 TGATAGAGTTGACCAAAAAAAGG + Intergenic
1166297363 19:41895620-41895642 TGACAGTGGTGACCAGGAGCAGG - Intronic
1167399076 19:49252857-49252879 AGACAGAGGTGAGCATCAGCAGG + Intergenic
927051582 2:19335531-19335553 TGACACAGTTGACCTTAAGCCGG + Intergenic
927221085 2:20710910-20710932 TGGCAGAGTTGACTTTAAGAAGG + Intronic
928752904 2:34491741-34491763 AGTCAGACTTGACAATAAGCTGG + Intergenic
930160544 2:48151770-48151792 TGAAAGAATTTACCATAAGAAGG - Intergenic
930403586 2:50924827-50924849 ATACAGAGTTGACCAGTAGCAGG - Intronic
930566953 2:53033102-53033124 TGAAAGAGCTCACCAGAAGCTGG + Intergenic
930976906 2:57474578-57474600 TGACAGAGCTGCCCATTTGCTGG + Intergenic
933350081 2:81142947-81142969 TGACAGAATTGAAAATAATCAGG - Intergenic
934156445 2:89205333-89205355 TGGCGGAGTTGACCACAAGAGGG - Intergenic
934210873 2:89977427-89977449 TGGCGGAGTTGACCACAAGAAGG + Intergenic
939765215 2:146239888-146239910 TGACAGAATTGAGTCTAAGCAGG - Intergenic
940899691 2:159115264-159115286 TGACAGAGTTAAGCAGAAGAGGG + Intronic
942662655 2:178282597-178282619 TGACAGAGTTCATCATAGGAAGG + Intronic
943472942 2:188317546-188317568 TGACAGACTGCACCATAATCTGG - Intronic
944300411 2:198118032-198118054 TTACAGAGCTTACAATAAGCAGG - Intronic
947588295 2:231370440-231370462 TCACAGAGTTGGCCCTGAGCTGG + Intronic
1169059036 20:2647535-2647557 TGACACAGTTAGCCATAGGCTGG + Intergenic
1171884428 20:30641487-30641509 TGAAAGAAATGACCATAAGTTGG - Intergenic
1173980698 20:47221620-47221642 TGCCAGAGTTTTCCAGAAGCTGG + Intronic
1174730963 20:52916981-52917003 AGTGAGTGTTGACCATAAGCTGG + Intergenic
1179234455 21:39532952-39532974 TGACAGACGTGACCTCAAGCTGG - Intergenic
1179308845 21:40179270-40179292 TGGCAGAGTTGGCCATCAGAGGG + Intronic
949587510 3:5456378-5456400 AGACAGAGTTGACTGTAGGCAGG - Intergenic
950329218 3:12143077-12143099 TGACAGAGAGGCCCAAAAGCAGG + Intronic
953749899 3:45601138-45601160 AGACAGAGTTGACCATACAAGGG + Intronic
955505122 3:59624925-59624947 AGACAGAGTTGTCCAAATGCAGG + Intergenic
956230810 3:67014286-67014308 TGGCAGAGTTCAACAAAAGCAGG - Intergenic
957774822 3:84744306-84744328 TGACACAACTGATCATAAGCAGG + Intergenic
958910698 3:99991019-99991041 TGACAAAGATGCCCATAATCTGG + Intronic
959082212 3:101813896-101813918 TGTCCCAGTTGACCATAAGGGGG + Intronic
963423583 3:145094047-145094069 TGACAGAGGTGAGGATAAGGGGG + Intergenic
970798229 4:19940666-19940688 TAACAGAGTTGAGCATAAGTAGG + Intergenic
973368083 4:49223760-49223782 TGAAAGAAATGACCATAAGTTGG - Intergenic
973392967 4:49571666-49571688 TGAAAGAAATGACCATAAGTTGG + Intergenic
975277782 4:72521696-72521718 AGACAGAATTTAACATAAGCTGG - Intronic
975682733 4:76892814-76892836 TAAAAGAGTTGACCAGACGCAGG + Intergenic
977805808 4:101295990-101296012 TAACAGATTTGAAAATAAGCTGG + Intronic
979024199 4:115547076-115547098 TGACACAGGTGCCCATATGCTGG + Intergenic
980347916 4:131647366-131647388 AGACAGAGTTGGACAAAAGCAGG + Intergenic
980389763 4:132128036-132128058 TGACTAAGTTGACCAAAAGAAGG - Intergenic
981884369 4:149655270-149655292 TGACAGAGTACACAATGAGCAGG + Intergenic
983664734 4:170168234-170168256 CAACAGAGATGACTATAAGCTGG - Intergenic
986697361 5:10369633-10369655 GGACAAAGTTGACCATAAAAGGG - Intronic
990417828 5:55603107-55603129 TGATAGAGTTCATCATTAGCAGG - Intergenic
995942775 5:117604950-117604972 TGACAGAGTTGATCTAAAGCTGG + Intergenic
997817051 5:137029015-137029037 GGACTCAGTTGACCATAAGCAGG - Intronic
1004230900 6:13832204-13832226 TGACATAGTAGACCTTAAGTAGG + Intergenic
1011401680 6:86969637-86969659 TGACAGAGATGACTAAAAGCTGG - Intronic
1015805017 6:137100122-137100144 GGACAGAATTGACCAGATGCTGG + Intergenic
1018145769 6:160886799-160886821 TGACACAGTGGTCCATATGCTGG - Intergenic
1018357417 6:163032867-163032889 TGAAAGAGCAGATCATAAGCAGG + Intronic
1023880814 7:44320316-44320338 GGTCAGAGTAGACCACAAGCTGG + Intronic
1026502295 7:70952942-70952964 TGACAGAATTGGCCACCAGCTGG + Intergenic
1027303820 7:76870797-76870819 TGACAGACTTCTCCATTAGCAGG + Intergenic
1030738845 7:113084478-113084500 TGACAGAGTTGAACACAAATGGG + Exonic
1037590597 8:20308849-20308871 GGGCAGTGTTGACCACAAGCAGG + Intergenic
1040053484 8:43037453-43037475 TGACATAGTTAAGCATAGGCTGG - Intronic
1041398762 8:57419270-57419292 GGATAGAGATGAGCATAAGCGGG + Intergenic
1042427733 8:68668652-68668674 TGACAGAGCTGACATTAAGATGG + Intronic
1044080888 8:87882009-87882031 TGACAGAGTAGTGCATAAGGTGG + Intergenic
1051992116 9:23163715-23163737 TGGCAGCATTTACCATAAGCTGG + Intergenic
1052419626 9:28225739-28225761 TTATAAAGCTGACCATAAGCAGG + Intronic
1053484620 9:38442466-38442488 TGTCAGAGCTGTCCAAAAGCGGG + Intergenic
1053567556 9:39269160-39269182 TGTGAGAATTGACCATAAACTGG - Intronic
1054129587 9:61349838-61349860 TGTGAGAATTGACCATAAACTGG + Intergenic
1055155083 9:73052924-73052946 TGACAGAGTTGACCATAAGCAGG - Intronic
1055387887 9:75783620-75783642 TGACAAAGTTGACAATAACAAGG - Intergenic
1057003260 9:91532358-91532380 TGACTGAGTTGTCCATTAGCTGG - Intergenic
1057190218 9:93083130-93083152 TGTCAGAGTGGCCCCTAAGCCGG - Intronic
1062536779 9:137024513-137024535 GGTCAGAGTAGACCACAAGCTGG - Intronic
1185800974 X:3010388-3010410 TGGGAGTGTTGACCATAAGTTGG - Intronic
1187616362 X:20998394-20998416 TGACACAGGTGCCCATATGCTGG - Intergenic
1189061847 X:37762165-37762187 TGACAGAGTTAATCAAAAGTTGG + Intronic
1194479325 X:94400970-94400992 TGACAACGTTTACCAAAAGCTGG - Intergenic
1195719814 X:107856234-107856256 TGACAGAGTGGAACATTAGAGGG - Intronic
1197843324 X:130774086-130774108 TAACAGAGTAGACCAAAAGATGG - Intronic