ID: 1055156272

View in Genome Browser
Species Human (GRCh38)
Location 9:73066702-73066724
Sequence CAGTTCCTTCAGAAGGTCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1058
Summary {0: 1, 1: 15, 2: 162, 3: 271, 4: 609}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055156272_1055156276 -8 Left 1055156272 9:73066702-73066724 CCACAGACCTTCTGAAGGAACTG 0: 1
1: 15
2: 162
3: 271
4: 609
Right 1055156276 9:73066717-73066739 AGGAACTGGATCACTGCTGGAGG No data
1055156272_1055156277 23 Left 1055156272 9:73066702-73066724 CCACAGACCTTCTGAAGGAACTG 0: 1
1: 15
2: 162
3: 271
4: 609
Right 1055156277 9:73066748-73066770 GACACTGAAAAACTGTGAGTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055156272 Original CRISPR CAGTTCCTTCAGAAGGTCTG TGG (reversed) Intronic
900002898 1:24753-24775 CAGTACCTGCAGAAGGTCTCTGG - Intergenic
900022618 1:195278-195300 CAGTACCTGCAGAAGGTCTCTGG - Intergenic
901113188 1:6816055-6816077 CAATTACGTCAGAATGTCTGGGG - Intronic
901638189 1:10680041-10680063 CAGCTCCTGCAGAAAGGCTGGGG + Intronic
901902163 1:12374506-12374528 CAGTTGATTAAGAAGGTGTGTGG + Intronic
903445349 1:23419110-23419132 CAGCTTCTTCAGAAGGTCCAGGG + Exonic
903464757 1:23544390-23544412 CAGTTCCTTCATCTGTTCTGTGG - Intergenic
903566186 1:24267484-24267506 CAGTTCCCCAAGTAGGTCTGTGG - Intergenic
904254143 1:29243903-29243925 CATTTCCTGCAGAATGACTGTGG + Intronic
904572639 1:31478179-31478201 TGCTTCCTTCAGAGGGTCTGTGG + Intergenic
904600762 1:31671456-31671478 CAGTCCCTGCAGATGCTCTGCGG + Intronic
904799465 1:33082305-33082327 GAGTTCCTTCAGCAGGTCTCGGG - Exonic
905497291 1:38402877-38402899 CACTTCCTTCAAAGGGTCTGTGG - Intergenic
906000102 1:42417424-42417446 ATGTTCCTTCAGCAGGCCTGTGG - Exonic
906054093 1:42900655-42900677 CACTTCCTTCAGAGGGCCTGTGG + Intergenic
906569415 1:46823301-46823323 TGCTTCCTTCAGAGGGTCTGGGG + Intergenic
906754010 1:48291738-48291760 CACTTCCTTCAAAGGGTCTGTGG + Intergenic
907349007 1:53810885-53810907 TGCTTCCTTCAGAGGGTCTGTGG - Intronic
908497093 1:64705355-64705377 CGGTTTCTTCTGAGGGTCTGGGG + Intergenic
908660780 1:66432636-66432658 CACTTCCTTCAAAGGGTCCGTGG + Intergenic
908802434 1:67894005-67894027 CAGTTCCTTCATAAACTCTGAGG - Intergenic
908803705 1:67907824-67907846 CGTTTCCTTCAGAGGGTCTGTGG + Intergenic
908981619 1:69966589-69966611 CGCTTCCTTCAGAGAGTCTGTGG - Intronic
909267432 1:73578282-73578304 TGGTTGCTTCATAAGGTCTGTGG - Intergenic
909673445 1:78213831-78213853 TACTTCCTACAGAGGGTCTGTGG - Intergenic
909828397 1:80154455-80154477 CACCTCCTTCAAAGGGTCTGTGG + Intergenic
910077473 1:83298296-83298318 CGCTTCCTTCAGAGGGTCTGTGG - Intergenic
910142280 1:84038775-84038797 CACTTCCTTCAGAGGGTCTGTGG + Intergenic
910380600 1:86622850-86622872 TGCTTCCTTCAGAGGGTCTGTGG - Intergenic
910708560 1:90155327-90155349 CAGTTCCTTCAAAGGGTCTGTGG + Intergenic
911323313 1:96440408-96440430 CAGTTCCTTCAAAGGGTCTGTGG + Intergenic
911561971 1:99417690-99417712 CAGTTCCTTTAAAGGCTCTGTGG - Intergenic
911679024 1:100692423-100692445 TACTTCCTTAAGAGGGTCTGTGG + Intergenic
912033170 1:105274943-105274965 CAGTTCCTTTAAAGGGTCTGTGG + Intergenic
913143116 1:115961836-115961858 AGATTCCTTCAGAGGGTCTGTGG - Intergenic
913339869 1:117747733-117747755 CACTTCCTTCAGAGGGTGTGTGG + Intergenic
914927029 1:151897701-151897723 CGCTTCCTTCAGAGGGTCTGTGG - Intronic
914967833 1:152277276-152277298 CACTTCCTTCAGAGGGTCTGTGG - Intergenic
915669648 1:157477882-157477904 CACCTCCTTCAGAGTGTCTGTGG + Intergenic
916166313 1:161969900-161969922 CAATTCAGTCAGAATGTCTGGGG - Intergenic
916263594 1:162868494-162868516 CACTTCCTCCAGAGGGTCTGTGG - Intronic
916331736 1:163625145-163625167 CATCTCCTTCAAAGGGTCTGTGG + Intergenic
916811729 1:168311878-168311900 CAGTTCAATCAGAATCTCTGGGG + Intronic
917058022 1:171004632-171004654 CACTTCCTTCAGAGGGTCTGTGG + Intronic
917318844 1:173758484-173758506 CGCTTTCTTCAGAGGGTCTGTGG - Intronic
917461453 1:175234196-175234218 CGCTTCCTTCAGAGGGTCTGTGG - Intergenic
917665919 1:177225563-177225585 CAGTTCCACCAGAAGTTGTGAGG + Intronic
917791917 1:178504449-178504471 CAGTTCCAGCAGGAGCTCTGGGG - Intergenic
917913715 1:179678400-179678422 CAGTTTCTTCAAAGGGTCTGTGG + Intronic
918154868 1:181835322-181835344 CACTTCCTTTAAAGGGTCTGTGG - Intergenic
918158224 1:181872021-181872043 CACTTCCTTCAGAGGGTCTTTGG - Intergenic
918159031 1:181880137-181880159 CACCTCCTTCAAAGGGTCTGTGG - Intergenic
918589170 1:186221814-186221836 AAGTTTCTTCAAAGGGTCTGTGG - Intergenic
918781130 1:188702027-188702049 CAGTTCCTACAGTTGGGCTGAGG - Intergenic
919125547 1:193388724-193388746 CTGTTGCTTCAGAGGGTGTGTGG - Intergenic
919397318 1:197068084-197068106 TACTTTCTTCAGAGGGTCTGTGG - Intergenic
919549546 1:198966836-198966858 CGCTTCCTTCAGAGGGTCTGTGG + Intergenic
919598471 1:199593516-199593538 CGCTTCCTTCAGAGGGTCTGTGG - Intergenic
920060309 1:203222693-203222715 AAGGTTCTTCAGAAGGCCTGGGG + Intronic
920505623 1:206513424-206513446 TGGTTCCCTCAGAAGGGCTGGGG - Intronic
920727092 1:208446164-208446186 TGCTTCCTTCAGAGGGTCTGTGG + Intergenic
920799883 1:209176705-209176727 CAGTTCCTTCAAAGGGTCTGTGG - Intergenic
920989706 1:210925370-210925392 AAGTTCCTTCAAAGGGTCTGTGG - Intronic
921063972 1:211609728-211609750 GAGTTCCTTCAGAAGGCCAGTGG + Intergenic
921399706 1:214707774-214707796 CAGTTCCTTCAACGGGTTTGTGG + Intergenic
921409948 1:214824248-214824270 CGCTTCCTTCAGAGGGTCTGTGG + Intergenic
921762930 1:218937621-218937643 CACCTCCTTCAAAGGGTCTGTGG + Intergenic
922319865 1:224477188-224477210 AAGTTCCTTCAAAGGGTGTGTGG + Intronic
922396190 1:225203081-225203103 CACTTTCTTTAGAGGGTCTGTGG + Intronic
922657769 1:227401257-227401279 CACTTCCTTCAGAGGGTCTGTGG - Intergenic
922673542 1:227533114-227533136 CACTTCCTTCAGAGGGTCTGTGG + Intergenic
923045090 1:230349926-230349948 CGGCTCCTTCTGCAGGTCTGAGG - Intronic
923128175 1:231050642-231050664 CAGGTCCTTCAGGAGGTTTCCGG - Intergenic
923458564 1:234187521-234187543 CGCTTCCTTCAAAGGGTCTGTGG - Intronic
923648077 1:235845095-235845117 CGCTTCCTTCAGAGGGTCTGTGG - Intronic
923776452 1:236983050-236983072 CTGTTCTTTGAGAAGGTGTGAGG - Intergenic
923808803 1:237289183-237289205 CGCTTCCTTCAGAGGCTCTGTGG + Intronic
923874555 1:238034021-238034043 CACTTCCTTCAGAGGGTCTGTGG - Intergenic
923937299 1:238777368-238777390 CATTTTCTTGAGAATGTCTGTGG + Intergenic
924321545 1:242855525-242855547 CACTTCCTTCATAGTGTCTGTGG + Intergenic
924609730 1:245563804-245563826 CGCTTCCTTCAGAGGGTCTGGGG - Intronic
924691421 1:246355442-246355464 CAGTTCCTTCAGAGGGTCTGTGG - Intronic
924878097 1:248128005-248128027 CAGTTCCTTCAAAGGGTCTGTGG + Intergenic
924880229 1:248152803-248152825 CAGTTCCTTCAAAGGGTCTCTGG + Intergenic
924883342 1:248187227-248187249 CAGTTCCTTCAAAGGATCTGTGG + Intergenic
924885419 1:248210333-248210355 CAGTTCCTTCAAAGGATCTGTGG + Intergenic
924894167 1:248317701-248317723 CAGTTCCTTCAAAGGGTCTGTGG - Intergenic
1063561363 10:7130864-7130886 CAGTTCCTTCAGGGGGTCTGTGG + Intergenic
1064101308 10:12466736-12466758 CAGATCCTTCCTAAGGTCAGAGG - Intronic
1064557263 10:16559730-16559752 CACCTCCTTCAAAGGGTCTGTGG + Intergenic
1064868061 10:19904629-19904651 CAGTTCCTTCAAAGGGTCTGAGG + Intronic
1065329924 10:24585272-24585294 CACTTCCTTCAGAATTTCTCCGG + Exonic
1065821844 10:29532888-29532910 CAGTTCCTTCTGATGCTCTAAGG + Exonic
1065894640 10:30152457-30152479 CAGTTCCTTCAAATGGTATTTGG + Intergenic
1066021944 10:31312560-31312582 GAGTTCCTTCAGAAGGGCCTAGG - Intergenic
1066145640 10:32554696-32554718 TGCTTCCTTCAGAGGGTCTGTGG + Intronic
1067234186 10:44434714-44434736 CACTTCCTTCAGAGGGTCTGTGG + Intergenic
1067744659 10:48926536-48926558 CAGTTCCTCCAAAAGGTCAGTGG - Intronic
1068173288 10:53422939-53422961 CACTTCCTTCAAAGGGTCTGCGG + Intergenic
1068835804 10:61552090-61552112 CAGTTTCTTCATAAGGTCGTTGG - Intergenic
1069325141 10:67224475-67224497 CGCTTCCTTCAAAGGGTCTGTGG - Intronic
1069345387 10:67463408-67463430 CAGTTTTTTCAGATGGTCTTTGG - Intronic
1069717791 10:70532094-70532116 CAGTTCCCTCAGTGGGTCTGTGG + Intronic
1071305819 10:84298133-84298155 CCTTTCCTTCAGAAGGACTTGGG + Intergenic
1071484601 10:86090750-86090772 TGCTTCCTTCAGAGGGTCTGTGG - Intronic
1071843568 10:89498696-89498718 CACCTCCTTCAGAGGGTCTGTGG - Intronic
1071932266 10:90485310-90485332 CGCTTCCTTCAAAGGGTCTGTGG + Intergenic
1072381817 10:94879918-94879940 CAGTTCCTTCAAAGGGTCTGTGG + Intergenic
1072769628 10:98126630-98126652 CAGTTCCTTCAAAGGGTCTGTGG + Intergenic
1072814933 10:98498212-98498234 CACTTCCTTCAGAGGGTCTGTGG - Intronic
1072885076 10:99265745-99265767 CACTTCCTTCAAAGGGTCTGTGG - Intergenic
1073960274 10:108919017-108919039 GGCTTCCTTCAGAGGGTCTGTGG - Intergenic
1074807899 10:117072429-117072451 CACTTCTTTCAGAGGGTGTGTGG - Intronic
1074985948 10:118659428-118659450 TGCTTTCTTCAGAAGGTCTGTGG + Intergenic
1075407726 10:122205678-122205700 CACTTCCTTCTGCAGGGCTGGGG - Intronic
1075499903 10:122963861-122963883 CAGTGCCTTCAGAAGTTCCCTGG - Intronic
1075707575 10:124510831-124510853 CAATTCCTTGAGAAGGGCAGAGG + Intronic
1077834324 11:5910945-5910967 CAGTTCCTTCAAAGGGTCTGTGG + Intronic
1077853127 11:6095394-6095416 CACTTCTTTCAGAGGGTCTGTGG - Intergenic
1077879663 11:6338914-6338936 CAGATCCTTCACAAGCTCTCTGG - Intergenic
1077997178 11:7464088-7464110 CAGTTCCTTCAGAATGCTTTGGG - Intronic
1078288452 11:9982693-9982715 CACTTCCTTCCGAGGATCTGTGG - Intronic
1079265519 11:18928404-18928426 AATTTTCTTCAGAATGTCTGCGG + Intergenic
1079827219 11:25212139-25212161 CACCTCCTTCAAAGGGTCTGTGG + Intergenic
1080153167 11:29076954-29076976 CACTTCCTTCAGAGGGTCTGTGG + Intergenic
1080324001 11:31049615-31049637 CACTTCCTTCAGAGGGTCTGCGG - Intronic
1080586017 11:33683208-33683230 CACTTCCTTCAGAGCGTCTATGG + Intergenic
1080672694 11:34395471-34395493 CGCTTCCTTCAGAGGGTCTGTGG + Intergenic
1081091186 11:38867757-38867779 CAGTTCCTTCAAAGGGTCTGTGG + Intergenic
1081195129 11:40152063-40152085 CATTTCCTTCAGAGGGTCTGTGG - Intronic
1081326815 11:41754829-41754851 CAGTTTCTTCAAAGGGTCTGTGG + Intergenic
1081579290 11:44340782-44340804 CAGCTACTTTAGAGGGTCTGTGG + Intergenic
1082723186 11:56704795-56704817 CACTTCCTTCAAAGGGCCTGTGG - Intergenic
1082903772 11:58284708-58284730 CACTTCCTTCAGAGGATCTGTGG - Intergenic
1082916722 11:58445910-58445932 CACTTCTTTCAGAGGGTCTGTGG - Intergenic
1082941098 11:58706469-58706491 CAGTTTCTTCAAATGGTCTGTGG - Intronic
1083072729 11:60003304-60003326 CACTTCCTTCAGAGGGCCTGTGG - Intergenic
1084237559 11:67797806-67797828 CGGGTCCTTGAGAAGCTCTGAGG - Intergenic
1084465381 11:69320269-69320291 CAGGTCTTCCAGCAGGTCTGGGG - Intronic
1084597768 11:70127337-70127359 CAGTTCCTGCAGAATTTCTCGGG - Intronic
1085917030 11:80902749-80902771 TGCTTCCTTCAGAGGGTCTGTGG - Intergenic
1086082854 11:82923114-82923136 CACTTCCTTCAGAGGGTCTGTGG + Intronic
1086264640 11:84983206-84983228 CGCTTCCTTCAGAGGGCCTGTGG - Intronic
1086297559 11:85387942-85387964 CACCTCCTTCAAATGGTCTGTGG - Intronic
1086677457 11:89626441-89626463 TAGTCCTTTCAGAAGGTCTAAGG - Intergenic
1086683806 11:89707136-89707158 CTCTTCATTCAGTAGGTCTGGGG - Intergenic
1086825559 11:91490577-91490599 CAATTCCTTCAGAGGGTTTGTGG + Intergenic
1086844305 11:91730021-91730043 TAGTTCCTTTGAAAGGTCTGTGG - Intergenic
1087602021 11:100328924-100328946 CAGTTCCTTCAAAGGGACTGTGG - Intronic
1087615812 11:100486036-100486058 CATTTCCTTCAGAGGGTCTGTGG - Intergenic
1087804275 11:102539000-102539022 CAGTTCCTTCAAAGGGTCTGTGG - Intergenic
1087817618 11:102676548-102676570 CAGTCCCTTCAAAGGGTCTGTGG + Intergenic
1087866202 11:103229226-103229248 CAGTTCCTTCAAAGGGTCTGTGG + Intronic
1088176067 11:107054274-107054296 CACTTCTTTCAAAGGGTCTGTGG - Intergenic
1088179350 11:107092009-107092031 TGCTTCCTTCAGAGGGTCTGTGG - Intergenic
1088239388 11:107758304-107758326 CACTTCCTTCAGAGGGTCTGTGG - Intergenic
1088372510 11:109106972-109106994 CAGTTCCTTTAGAGGGTCTGTGG + Intergenic
1088388173 11:109282306-109282328 CGCTTCCTTCAAAGGGTCTGTGG + Intergenic
1088730452 11:112677132-112677154 TGCTTCCTTCAGAGGGTCTGTGG + Intergenic
1088887809 11:114021309-114021331 GAGGTCCTACAGATGGTCTGGGG - Intergenic
1088928766 11:114328088-114328110 AAGTTACTTTAGAAGTTCTGAGG - Intergenic
1088951185 11:114571796-114571818 CTGTTCCTTCAAAGGGTCTATGG - Intronic
1089107257 11:116023404-116023426 CGCTTCCTTTAGAGGGTCTGTGG - Intergenic
1089783926 11:120894692-120894714 CTGTTCCTACAGGAGGTTTGGGG + Intronic
1089826453 11:121282082-121282104 TGCTTCCTTCAGAGGGTCTGTGG + Intergenic
1090559474 11:127915262-127915284 TACTTCCTTCAGAGAGTCTGTGG + Intergenic
1090752902 11:129763269-129763291 CACTTCCTTCAGAGGGTCTGTGG - Intergenic
1090895139 11:130965090-130965112 CACTTCCTTCAGAGGGTCTGTGG + Intergenic
1091210662 11:133855190-133855212 CACTTGCTTCAGAGGGTCTGTGG + Intergenic
1091376316 12:26816-26838 CAGTACCTGCAGAAGGTCTCTGG - Intergenic
1092084500 12:5744608-5744630 AAGTCCCTTCAGAACATCTGGGG + Intronic
1092303837 12:7279479-7279501 TGCTTCCTTCAGAGGGTCTGTGG + Intergenic
1092727534 12:11500064-11500086 CAGTGCCTGCAGAAGGTCCCTGG + Intronic
1093172196 12:15873959-15873981 GGCTTCCTTCAGAGGGTCTGTGG - Intronic
1093277472 12:17148120-17148142 CACTTTCTTCAAAGGGTCTGTGG - Intergenic
1093524605 12:20092321-20092343 CACTTCCTTCAGAGGGTCTGTGG - Intergenic
1093604560 12:21074119-21074141 CAGTTTCTTCAAAGGGTTTGTGG + Intronic
1093646778 12:21595274-21595296 TACTTCCTTCAGAGGGTCTGTGG - Intronic
1093690874 12:22107405-22107427 TAGTTCTTTCAAAGGGTCTGTGG - Intronic
1093720437 12:22436707-22436729 CGCTTCCTTCAGAGGGTCTGTGG - Intronic
1093758254 12:22876516-22876538 CACCTCCTTCAAAGGGTCTGTGG + Intergenic
1093769636 12:23003610-23003632 CAGTTGCATAAGAAGGTTTGTGG - Intergenic
1093991287 12:25592329-25592351 TGCTTCCTTCAGAGGGTCTGTGG - Intronic
1094263600 12:28528507-28528529 CACTTCCTTCAGAGGGTCTGTGG + Intronic
1094718441 12:33035382-33035404 CATTTCCTTCAGAGGGTCTGTGG + Intergenic
1094801915 12:34047647-34047669 CACTTCCTTTAGAGGGTCTGTGG - Intergenic
1095115045 12:38343552-38343574 CGCTTCCTTCAGAGGGTCTGTGG - Intergenic
1095178764 12:39123068-39123090 CACCTCCTTCAAAGGGTCTGTGG + Intergenic
1095931939 12:47636454-47636476 CGCTTCCTTCAGAGGGTCTGTGG - Intergenic
1096347818 12:50866155-50866177 TGCTTCCTTCAGAGGGTCTGTGG - Intronic
1096876649 12:54634870-54634892 CAGAATCTGCAGAAGGTCTGGGG + Exonic
1097295346 12:57957499-57957521 CGCTTCCTTCAGAGGGTCTGTGG - Intergenic
1097760399 12:63458789-63458811 TGCTTCCTTCAGAGGGTCTGTGG - Intergenic
1097870585 12:64598602-64598624 CAGTGCCCTCAGAATTTCTGTGG - Intergenic
1098500480 12:71186806-71186828 CACTTCCTTCAGAGGGCCTGTGG - Intronic
1098852267 12:75611068-75611090 CAGCTCCTTCAAAGGGTCTGTGG - Intergenic
1098910518 12:76204113-76204135 CGCTTCCTTCAGAGGGTCTGTGG - Intergenic
1098961057 12:76739866-76739888 CGCTTCCTTCAGAAGGTCTGTGG + Intergenic
1099041929 12:77667257-77667279 CAGTTCCTTCAAAGGGTCTGTGG - Intergenic
1099101913 12:78452498-78452520 TAGTTCCTTCTGAGGCTCTGAGG - Intergenic
1099418637 12:82424907-82424929 TAGAGCCTTCAGAGGGTCTGTGG + Intronic
1099473172 12:83075253-83075275 CACTTCCTTCAAAGGGTCTGTGG + Intronic
1099477328 12:83122701-83122723 CCCTTCCTTCAGAGGGTATGTGG + Intronic
1099803575 12:87488415-87488437 TGCTTCCTTCAGAGGGTCTGTGG + Intergenic
1100203725 12:92326130-92326152 CGCTTCCTTCAGGGGGTCTGTGG + Intergenic
1100291126 12:93215620-93215642 CACTTCTTTCAGAGGGTCTGTGG + Intergenic
1100669634 12:96796162-96796184 CACTTCCTTCAGAGGGTCAGTGG + Intronic
1100697196 12:97107786-97107808 TGCTTCCTTCAGGAGGTCTGTGG + Intergenic
1101290253 12:103361136-103361158 CACTTTCTTCATAGGGTCTGTGG - Intronic
1101544499 12:105698463-105698485 CAGTTCCTTCAAAAGGTCTGTGG + Intergenic
1102172508 12:110852942-110852964 CGGTTCCTTCAAGATGTCTGTGG + Exonic
1102699453 12:114826351-114826373 CAGTGGCTACAGAAGGCCTGGGG - Intergenic
1102916883 12:116760717-116760739 CGTTTCCTTCAGAGAGTCTGTGG + Intronic
1103201859 12:119094370-119094392 CTGATTCTTCAGTAGGTCTGGGG - Intronic
1103475090 12:121211979-121212001 CAATTAAATCAGAAGGTCTGGGG - Intronic
1103692989 12:122790967-122790989 CTGTTCCTTGAGTATGTCTGTGG - Intronic
1103761257 12:123251715-123251737 CGCTTCCTTCAGAGGGTCTGTGG + Intronic
1104403822 12:128500683-128500705 CAGTTTCTTCCCAACGTCTGTGG - Intronic
1104648417 12:130513476-130513498 CTGTTCCTGTAGCAGGTCTGAGG - Intronic
1105251452 13:18702164-18702186 CAGTTCCTGCAAATGGTGTGGGG + Intergenic
1105314333 13:19243581-19243603 CACTTTTTTCAGAAGGTCTGTGG - Intergenic
1106978265 13:35247663-35247685 CACTTCCTTCAAAGGGTCTGTGG + Intronic
1107010197 13:35662634-35662656 CAGTTTATTCAGATGATCTGGGG + Intronic
1107184697 13:37505119-37505141 CACTTCCTTCAGAGGGTCTGTGG - Intergenic
1107267086 13:38568638-38568660 CAGTTGCTTTAAATGGTCTGTGG - Intergenic
1107525276 13:41224629-41224651 CAGTTACATCAGAATCTCTGGGG + Intronic
1107756135 13:43623609-43623631 CACTTCCTTCAGAGGGTGTGTGG + Intronic
1108188829 13:47916762-47916784 CACTTCCTTTAAAGGGTCTGTGG - Intergenic
1108298778 13:49053215-49053237 CAGTTGCTTTAGAGGGTCTGTGG + Intronic
1108469921 13:50757100-50757122 CGCTTCTTTCAGAGGGTCTGTGG + Intronic
1108831609 13:54486681-54486703 CAGTTTCTTCAAAGGGTCTGTGG - Intergenic
1109048067 13:57438357-57438379 CACTTCCTTCAGAGGGCCTGTGG + Intergenic
1109150602 13:58843230-58843252 CATTTCCTTCAAAGGATCTGTGG - Intergenic
1109484530 13:63001702-63001724 CACCTCCTTCTGAGGGTCTGTGG - Intergenic
1109570373 13:64180217-64180239 AAGTTCATTCAGAAGGTTGGTGG + Intergenic
1109945170 13:69423366-69423388 CACTTCCTTCAAAGGGCCTGTGG - Intergenic
1110181739 13:72625787-72625809 CAGTTCCTTCAAAGGGTCTGTGG - Intergenic
1110204395 13:72895790-72895812 CGCTTCCTTCAGAGGGTCTGTGG - Intronic
1110340974 13:74389236-74389258 CAGTTCCTTCAAAGGGTCTGTGG + Intergenic
1110504680 13:76271921-76271943 CACTTCCTTCAAAGGGTTTGTGG - Intergenic
1110852765 13:80263367-80263389 CACTTCCTTCAAAAGGTCTGTGG + Intergenic
1111165897 13:84456240-84456262 CACTTTTTTCAGATGGTCTGTGG + Intergenic
1111988436 13:95090044-95090066 CACTTCCTTCAAAGGGTCTGTGG - Intronic
1112035514 13:95493051-95493073 CGCTTCCTTCAGAGGGTCTGCGG + Intronic
1112086847 13:96041105-96041127 CATTTCCTTCAGAGGGTCTGTGG - Intronic
1112737948 13:102442751-102442773 AGCTTCCTTCAGAGGGTCTGTGG - Intergenic
1112747385 13:102541912-102541934 CGGGTCCTTCAGAGGGTCTGTGG - Intergenic
1113329811 13:109317221-109317243 CACTGCCTTGAGAGGGTCTGTGG - Intergenic
1113535014 13:111059053-111059075 CACCTCCTTCAAAGGGTCTGTGG + Intergenic
1113638279 13:111937243-111937265 CACTTCCTTCAGAGGGTCTGTGG + Intergenic
1113828510 13:113275644-113275666 CGGTCCATTCAGATGGTCTGAGG + Intergenic
1113889084 13:113726593-113726615 CAGGTCCCTCAGGAGGCCTGGGG + Intronic
1114329132 14:21618272-21618294 CACTTCCTCCAAAAGGTCTGTGG + Intergenic
1114697701 14:24643303-24643325 CACTTCTTTCAAAGGGTCTGTGG - Intergenic
1114747085 14:25160626-25160648 CAAGTGGTTCAGAAGGTCTGTGG + Intergenic
1114781730 14:25545730-25545752 GAGTGCCTTCAGTAGTTCTGAGG + Intergenic
1114832500 14:26162326-26162348 CAGTCCCTTTATAAGGTTTGGGG + Intergenic
1115265016 14:31492380-31492402 TGCTTCCTTCAGAGGGTCTGTGG - Intronic
1115299113 14:31864908-31864930 TGCTTCCTTCAGAGGGTCTGTGG - Intergenic
1115393284 14:32877722-32877744 CATTTCCTTCAAAGGGTCTGTGG + Intergenic
1115527194 14:34293166-34293188 TGCTTCCTTCAGAGGGTCTGTGG + Intronic
1115835623 14:37398352-37398374 TACTTCCTTCACAGGGTCTGTGG + Intronic
1115938198 14:38578624-38578646 CAGTTCCTTCAAAGGGTCTGCGG + Intergenic
1115958396 14:38808379-38808401 CACTTCCTTAAGAGGATCTGTGG - Intergenic
1116346575 14:43802555-43802577 CACTTCCTTCAGAGGGTCTGTGG - Intergenic
1116462960 14:45198749-45198771 CAGTTCCTTTAGCAAATCTGCGG - Exonic
1117103837 14:52378671-52378693 CAGTTCCTTCAAAGGGTCTTTGG + Intergenic
1117112628 14:52474922-52474944 CACTTCCTTCAGAGGGTCTGTGG - Intronic
1117510918 14:56449510-56449532 CACTTCCTTCAGAGGGTCTGTGG + Intergenic
1117639697 14:57785529-57785551 TGCTTCCTTCAGAGGGTCTGTGG - Intronic
1118165457 14:63331900-63331922 CACTTCCTTCAGAGGGCCTGTGG - Intergenic
1118532318 14:66719515-66719537 CTCTTTCTTCAGAGGGTCTGTGG + Intronic
1118632056 14:67714499-67714521 CAGTTCCTTCTGAAAGGCTAGGG - Intronic
1120146657 14:80986075-80986097 CAGTTCTTTCATAATATCTGGGG + Intronic
1120400387 14:84023312-84023334 TAGTTCCTTCAAAGGGTCTGTGG + Intergenic
1120450970 14:84666232-84666254 TAGTTCCTTCAGATGCTCTGTGG + Intergenic
1120545737 14:85809103-85809125 CACTTCCTTCAGAGGGTCTGTGG + Intergenic
1120977751 14:90264548-90264570 CAGTGCCTTCAGCAGCCCTGGGG + Intronic
1121459716 14:94065615-94065637 CAGTTCCTTCAGAGGGTCTGTGG - Intronic
1121848493 14:97196765-97196787 CAGCTCCTTCAAAGGGTCTGTGG + Intergenic
1121880685 14:97498029-97498051 CAGCTCCTGCAGATGGACTGGGG - Intergenic
1121956006 14:98214020-98214042 CACTTCCTTCAGAAGACCTCTGG + Intergenic
1122298716 14:100719854-100719876 CAGTTCCTTCACTAGGAATGTGG - Intergenic
1122464687 14:101923256-101923278 CTGTCCTTTCAGAAGCTCTGGGG + Intronic
1122867853 14:104617058-104617080 CACTTCTTTCAGAAAGTCGGGGG + Intergenic
1123155095 14:106217312-106217334 CAGTTTATTCTGAAGGTCTCAGG - Intergenic
1123181619 14:106476709-106476731 CAGTTAATTCTGAAGGTCTCAGG - Intergenic
1202945285 14_KI270726v1_random:20019-20041 CAGTTAATTCTGAAGGTCTCAGG + Intergenic
1123401764 15:19994455-19994477 CAGTTTATTCTGAAGGTCTCAGG - Intergenic
1123511104 15:21001116-21001138 CAGTTTATTCTGAAGGTCTCAGG - Intergenic
1123700133 15:22908255-22908277 CGCTTCCTTCAGAGGGTCTTTGG - Intronic
1124098073 15:26667762-26667784 CAGTTTATTCAGAAACTCTGGGG + Intronic
1124103380 15:26716042-26716064 CACTTGCTTTAGAAGGTGTGGGG - Intronic
1124127336 15:26947998-26948020 CTGTTCCTTCGGAATGTTTGGGG - Exonic
1124504960 15:30264702-30264724 CAGTTCCTTCAAAGGGTCTGTGG - Intergenic
1124556992 15:30735719-30735741 TGCTTCCTTCAGAGGGTCTGTGG - Intronic
1124674272 15:31670025-31670047 TGCTTCCTTCAGAGGGTCTGTGG + Intronic
1124701911 15:31921757-31921779 AATGTCCTTCAGTAGGTCTGTGG - Intergenic
1124738592 15:32273933-32273955 CAGTTCCTTCAAAGGGTCTGTGG + Intergenic
1125269533 15:37922351-37922373 CACTTCCTTCAGAGGGTCTCAGG + Intronic
1125518782 15:40337070-40337092 CTGTTTCTACAGTAGGTCTGGGG + Intronic
1126190195 15:45871115-45871137 CACCTCCTTCAAAGGGTCTGTGG - Intergenic
1126441828 15:48697747-48697769 CAGATCCTTCAGAAGTGCTCTGG + Intergenic
1126460940 15:48913979-48914001 TGCTTCCTTCAGAGGGTCTGTGG + Intronic
1126572591 15:50168291-50168313 TACTTCCTTCAGAGGGTCTGTGG - Intronic
1126577360 15:50210253-50210275 CACTTCTTTCAGAGGGTCTGTGG - Intronic
1126951204 15:53883941-53883963 AAATTCCTACAGAAAGTCTGAGG + Intergenic
1127031010 15:54863194-54863216 CACTGCCTTCAGAGGGTCTGTGG - Intergenic
1127194331 15:56568118-56568140 TGCTTCCTTCAGAAGGTCTGTGG - Intergenic
1127963603 15:63907982-63908004 GGGCTGCTTCAGAAGGTCTGAGG + Exonic
1128238582 15:66084419-66084441 TGCTTCCTTCAGAGGGTCTGTGG - Intronic
1129562885 15:76590059-76590081 CACTTCCTTCAGAGGGTCTGTGG + Intronic
1129631617 15:77266826-77266848 CAGCTCCTTCAAAGGGTCTGTGG - Intronic
1130045373 15:80440185-80440207 CACTTTCTTCTGATGGTCTGCGG + Intronic
1130404605 15:83587044-83587066 CAGCTCCTGCAGAATCTCTGTGG - Exonic
1132175620 15:99711675-99711697 CAGTTACTTCAGAATGGATGAGG - Intronic
1132412847 15:101597659-101597681 CATCTCCTTCAAAGGGTCTGTGG + Intergenic
1132450612 15:101966186-101966208 CAGTACCTGCAGAAGGTCTCTGG + Intergenic
1133473371 16:6096890-6096912 CAGGTGGTTCAGTAGGTCTGAGG - Intronic
1134046204 16:11103084-11103106 CATTTCCGCCAGAAGGTCCGGGG - Intronic
1135434686 16:22418628-22418650 CAGTTAAATCAGAATGTCTGGGG + Intronic
1135883290 16:26279942-26279964 CAGTTCCTTCAGAGCATCTGTGG + Intergenic
1136932203 16:34429166-34429188 CACTTCCTTCAGAGGGTATGTGG - Intergenic
1136972369 16:34982648-34982670 CACTTCCTTCAGAGGGTATGTGG + Intergenic
1136994820 16:35182319-35182341 CATTTCCTGCAGAGGGACTGTGG - Intergenic
1137419775 16:48322493-48322515 CAGGTCCTTCAGAAGGTAGAAGG - Intronic
1138276045 16:55735871-55735893 CAATTCCTACAAAAGTTCTGGGG + Intergenic
1138798115 16:59993927-59993949 CGCTTCCTTCAGAGGGTCCGTGG + Intergenic
1140015959 16:71184961-71184983 CATTTCCTTCAGGAACTCTGAGG + Exonic
1140619756 16:76716242-76716264 CACTTCCTTCAGAGGGCCTGTGG - Intergenic
1141908828 16:87044870-87044892 GAGCTCCCTCAGCAGGTCTGTGG - Intergenic
1142841181 17:2631723-2631745 CGCTTCCTTCAGAGGGTCTGTGG + Intronic
1143554845 17:7653550-7653572 GAGTTCCTTCTGGAGGTTTGGGG - Intronic
1144278475 17:13699908-13699930 CGCTTCCTTCAGAGGGTCTGTGG + Intergenic
1144783181 17:17817900-17817922 CAGATCCTTCAGAGATTCTGTGG + Exonic
1146583272 17:34059113-34059135 CACTTCCTTCAGAGGGTCTGTGG - Intronic
1147463251 17:40589407-40589429 CGCTTCCTTCAGAGGGTTTGTGG + Intergenic
1147890845 17:43715729-43715751 CACTTCCTGCAGAGGATCTGTGG + Intergenic
1148454730 17:47804932-47804954 CAGTCCCATCTGAAGGACTGTGG - Intergenic
1148959746 17:51383634-51383656 CAGCTCCTTGAGGAGGTCTTCGG + Intergenic
1149122388 17:53185112-53185134 CACTTCCTTCAGAGGGTCTGTGG + Intergenic
1149221284 17:54417939-54417961 CACTTCCTTCAAAGGGTCTGTGG - Intergenic
1150117121 17:62562722-62562744 CAGCTACTTCAGAAGGTTTTTGG + Intronic
1150528601 17:65953448-65953470 CAGTTCTTTCAAAGGGTCTGTGG - Intronic
1150538811 17:66075815-66075837 CTCTTCCTTCAGAGGGTCTGGGG - Intronic
1151980035 17:77503214-77503236 CAGCTCCTTCAGAACCTCTGGGG - Intergenic
1152085615 17:78216323-78216345 CAGTTCCTTGAGAATGTTGGAGG + Intronic
1152813346 17:82392583-82392605 CACAGCCTTCAGAGGGTCTGCGG + Intronic
1152858591 17:82680802-82680824 CAGTTGCATCACAAGGTCAGGGG + Intronic
1153069617 18:1089936-1089958 CGATTCCTTCAGAGGGTCTGTGG + Intergenic
1153400341 18:4678370-4678392 CATTTCCTTCAGAGGGTCTGTGG - Intergenic
1153822321 18:8842856-8842878 CAGTTACATCAGGAGGTCTCGGG - Intergenic
1153869370 18:9303064-9303086 CACTTCCTTCAGAAGGTCTGTGG - Intergenic
1154297735 18:13165264-13165286 CACTTCTTTCAAAGGGTCTGTGG - Intergenic
1155055278 18:22176949-22176971 CAGGTCCTCCAGCAGGTCTGCGG - Exonic
1155215019 18:23635691-23635713 CCCTGCCTTCAGTAGGTCTGGGG + Intronic
1155491055 18:26402254-26402276 CATCTCATTCAAAAGGTCTGGGG - Intergenic
1156011513 18:32502066-32502088 CACTTCCTTCAAAGGGTCTGTGG + Intergenic
1156259595 18:35432589-35432611 GATTTCCTTCAGCAGGGCTGAGG - Intergenic
1156607182 18:38680136-38680158 CAGCTCCTTCAAAGGGTCTATGG + Intergenic
1156642479 18:39119332-39119354 CAGTTCCTTCGAAAGGTCTCTGG - Intergenic
1156835532 18:41548961-41548983 CAATCCCTTCAGAAGATATGAGG - Intergenic
1157210523 18:45738226-45738248 CACTGCCTCCAGAAGGTCTTTGG + Intronic
1157218476 18:45806459-45806481 TGCTTCCTTCAGAGGGTCTGTGG - Intergenic
1157540833 18:48505408-48505430 CACTTCCTTCAGAGGATCTGTGG - Intergenic
1158555185 18:58469152-58469174 CAATTCAATCAGAAGCTCTGGGG + Intergenic
1158829627 18:61263434-61263456 CTTTTCCTTCAGAGGGTCTGTGG - Intergenic
1159454169 18:68639287-68639309 CACTTCCTTCAAAGGGTCTATGG + Intergenic
1159786961 18:72726475-72726497 CACTTCCTTCAGAAGGTCTGTGG - Intergenic
1159838397 18:73369079-73369101 CGGTTCCTTCGAAGGGTCTGTGG - Intergenic
1160219774 18:76966104-76966126 CACTTCCTTCAGAGAGTCTGTGG + Intronic
1160267734 18:77354428-77354450 CACTTCCTTCAGAGGGTCTGTGG + Intergenic
1160545902 18:79655163-79655185 AAGTTTCTTCAGAAGTTTTGTGG - Intergenic
1160634649 19:66361-66383 CAGTACCTGCAGAAGGTCTCTGG - Intergenic
1160723602 19:608168-608190 CAGTACCAGGAGAAGGTCTGAGG + Exonic
1164044706 19:21526811-21526833 TGCTTCCTTCAGATGGTCTGTGG + Intronic
1164267325 19:23632225-23632247 CATTTTCTTCAGAGGGTCTGTGG - Intronic
1165230683 19:34384676-34384698 CAGGTCTCTCAGGAGGTCTGAGG + Intronic
1166604392 19:44127415-44127437 CACTTCCTTCAGAGGGTCTGTGG + Intronic
1167203666 19:48085685-48085707 CACTTCCTTCAAAGGGACTGTGG - Intronic
1168679799 19:58306219-58306241 CAGTTCCCTGAGAAGGTATCGGG + Intronic
925127476 2:1469842-1469864 CGCTTTCTTCAGAGGGTCTGCGG + Intronic
925441963 2:3895646-3895668 CACCTCCTTCAAAGGGTCTGTGG + Intergenic
925652378 2:6104657-6104679 CAGTTCCCTCAAAGGGTATGTGG + Intergenic
925705492 2:6681206-6681228 CACCTCCTTCAAAGGGTCTGTGG - Intergenic
925785160 2:7424764-7424786 CAGGTCCTTCAGCAGATCTGAGG - Intergenic
925795721 2:7540012-7540034 CAGTTCCCGCAAAGGGTCTGTGG + Intergenic
926916142 2:17893795-17893817 CGCTTCCTTCAGAGGGTCTGTGG + Intronic
927036776 2:19185465-19185487 AAGTTCCTTCAAAGGGTCTGTGG + Intergenic
927069821 2:19516364-19516386 CAGTTTCTTCAAAGGGTCTGTGG + Intergenic
927119547 2:19943736-19943758 CAGTACCTTCAGAGGGTCACTGG + Intronic
927176881 2:20416005-20416027 TAGTTCCTTCTAAGGGTCTGTGG + Intergenic
927355399 2:22167358-22167380 CGATTCCTTCAAAAGGTCTGTGG - Intergenic
927818726 2:26244359-26244381 CAGTCTCTTCAGAAGGTCACGGG + Intronic
927920229 2:26966632-26966654 AAGTTGCTTCAGCAGGTCTGAGG + Intergenic
928443367 2:31311931-31311953 CACTTCCTTCAGAGGGTCTGTGG + Intergenic
928733604 2:34260998-34261020 GGCTTCCTTCAGAGGGTCTGTGG - Intergenic
928772664 2:34720343-34720365 CGCTTCCTTCAGAGGGTCTGTGG + Intergenic
928861578 2:35863644-35863666 CAGTTCCGACAGAAGTTCTATGG - Intergenic
929805877 2:45144805-45144827 TGCTTCCTTCAGAGGGTCTGTGG - Intergenic
930486634 2:52018526-52018548 TTCTTCCTTCAGAAGGTTTGTGG + Intergenic
930593059 2:53353337-53353359 CAGTTCCTTCAAAGGGTCGGTGG - Intergenic
931282775 2:60808502-60808524 GAGTTCCTGCAGCAGGTCTGGGG - Intergenic
931547749 2:63408194-63408216 CGCTTCCTTCAGAGAGTCTGTGG - Intronic
931553816 2:63477645-63477667 TACTTCCTTCAGAGGGTCTGTGG - Intronic
931992879 2:67809073-67809095 TGCTTCCTTCAGAGGGTCTGCGG - Intergenic
932270238 2:70403076-70403098 CACTTCCTTCAGAGGGTCTGTGG - Intergenic
932385035 2:71324060-71324082 CACTTCCTTCAGAGGATCTGTGG + Intronic
932714677 2:74092748-74092770 CCTTTCCTTCAGGAGGGCTGTGG - Intronic
932932862 2:76062797-76062819 CACTTCTCTCGGAAGGTCTGAGG - Intergenic
932954775 2:76338027-76338049 CACTTTCTTCAGAGAGTCTGTGG + Intergenic
933349450 2:81135888-81135910 CACTTCTTTCAAAGGGTCTGTGG - Intergenic
933531387 2:83517043-83517065 CACTTCCTTCAGAGGGTCTGTGG - Intergenic
933834097 2:86231900-86231922 CAGAGGCTTCAGTAGGTCTGGGG - Intronic
935006988 2:99089009-99089031 CTCTTCCTTCAAAGGGTCTGTGG - Intronic
935980690 2:108624157-108624179 CAATGCCTTGTGAAGGTCTGGGG - Intronic
936566828 2:113588666-113588688 CAGTACCTGCAGAAGGTCTCTGG + Intergenic
936801923 2:116280111-116280133 TGGTTCCTTCATAACGTCTGTGG - Intergenic
936843759 2:116804913-116804935 TGCTTCCTTCAGAGGGTCTGTGG + Intergenic
936850685 2:116894779-116894801 CAGTTCCTTCAAAGGGTCTGTGG - Intergenic
936899346 2:117466460-117466482 CATTTCCTTCAAAAGATCTGTGG + Intergenic
936971155 2:118177487-118177509 CAGAGCCTTCAGAAGACCTGAGG + Intergenic
937057720 2:118953674-118953696 CACTTCCTTCAGAGGGTCTGTGG - Intronic
937521651 2:122720247-122720269 CCCTTCCTTCAGAGGGTCTGTGG - Intergenic
937529158 2:122808155-122808177 CGCTTCCTTCAGAGAGTCTGTGG - Intergenic
937699494 2:124847608-124847630 CAGTTCCTTCAAAGGGTCTGTGG + Intronic
938038295 2:128054418-128054440 CACTTCCTTCAGAGGGTCTGTGG + Intergenic
938216700 2:129523596-129523618 CAACTCCTTCAAAGGGTCTGTGG + Intergenic
938674160 2:133614108-133614130 CAGTTTCTTCAAAGGCTCTGCGG - Intergenic
938996326 2:136682918-136682940 CAGTTCCTTCAAAGGGTCTGTGG - Intergenic
939305025 2:140400732-140400754 CACTTCTTTCAAAGGGTCTGTGG - Intronic
940045979 2:149409919-149409941 CAGTTCCTTCTAAGGGCCTGTGG + Intronic
940216490 2:151308947-151308969 CTCTTCCTTCAGAGGGTCTGTGG - Intergenic
940381907 2:153024771-153024793 CCCTTCTTTTAGAAGGTCTGAGG - Intergenic
940423792 2:153508710-153508732 CAGTTCCTTCAAAGGGTTTATGG + Intergenic
940431217 2:153592691-153592713 CATTTCCTTCAGAGGGTCTGTGG - Intergenic
940618816 2:156084515-156084537 CGCTTCCTTCAGAGGGTCTGTGG + Intergenic
940796932 2:158089882-158089904 CACTTCCTTCAAAGGGTCTGTGG + Intronic
941023659 2:160437267-160437289 GAGTTCCTTTAGAAGGGCTCAGG - Intronic
941357771 2:164514312-164514334 CATTTCCTTCAAAGGGTCTGTGG - Intronic
941627300 2:167844357-167844379 CGCTTCCTTCAGAGGGTCTGTGG - Intergenic
941631759 2:167891831-167891853 CGCTTCCTTCAGGGGGTCTGTGG + Intergenic
943449411 2:188028994-188029016 CACCTCCTTCAAAGGGTCTGCGG + Intergenic
943621284 2:190150587-190150609 CACTTCCTTCAGAGGGTGTGTGG + Intronic
943909198 2:193542001-193542023 CACTTCCTTCAGAGGGTCAGTGG - Intergenic
943937275 2:193935475-193935497 TCCTTCCTTCAGAGGGTCTGTGG + Intergenic
944136310 2:196403779-196403801 TATTTCCTTCAAAAGATCTGAGG - Intronic
944420009 2:199519594-199519616 CAGTCCCTTGAGCAGGTCTCAGG + Intergenic
944485319 2:200199563-200199585 CAATTCCTTCAAAGGGTCTGTGG - Intergenic
944529022 2:200649481-200649503 CACTTCCTTCAGAGGGTTTGTGG + Intronic
944601989 2:201312822-201312844 CACTTCCTTCAGAGGGTCTGTGG - Intronic
945362224 2:208906218-208906240 CACTTCCTTCAAAGGGTGTGTGG - Intergenic
945377354 2:209094482-209094504 CAGTTCCTTCAAAGGGTCTGTGG + Intergenic
945549681 2:211205347-211205369 GAGTTCCTTCTGAAGGTGTGAGG + Intergenic
945657688 2:212644773-212644795 CACCTCCTTCAAAGGGTCTGTGG + Intergenic
945825499 2:214716449-214716471 CTCTTCCTTCCGAGGGTCTGTGG - Intergenic
946036393 2:216745966-216745988 TGCTTCCTTCAGAGGGTCTGTGG - Intergenic
946208101 2:218125400-218125422 CACTTCTTTCAAAAGTTCTGTGG + Intronic
946501336 2:220250445-220250467 TGCTTCCTTCAGAGGGTCTGTGG - Intergenic
946924490 2:224613145-224613167 CTGTTCCTTTAGCAGCTCTGGGG + Intergenic
947235993 2:227941382-227941404 CACTTCCTTCAAAGGGTCTGTGG + Intergenic
947270203 2:228326448-228326470 CACTTCCTTCAGAGGGTCCATGG - Intergenic
947889414 2:233603787-233603809 CAGATCCTCCAGAATGTATGAGG - Intergenic
947960015 2:234228607-234228629 CAGGTCCTTCAGAAGGTTGCTGG - Intergenic
947960203 2:234229976-234229998 CAGGTCCTTCAGAAGGCTTCAGG - Intergenic
948388075 2:237593947-237593969 CAGATACTTAAGAGGGTCTGGGG + Intronic
948455959 2:238104732-238104754 CAGTTCCTGGTGAAGGACTGTGG + Exonic
948531066 2:238606014-238606036 CGATTCCTTCAGAGGGTCTGTGG - Intergenic
948703351 2:239774542-239774564 TAGTTCTTCCAGAAGCTCTGGGG + Intronic
948713874 2:239846562-239846584 CACTTCCTTCAGAGGGTCTGTGG - Intergenic
1168748624 20:266344-266366 CGTTTCCTTCAGAGGGTCTGTGG + Intergenic
1169517606 20:6333913-6333935 TGCTTCCTTCAGAGGGTCTGTGG + Intergenic
1170086201 20:12535249-12535271 CAGATCCTTCAAAGGGTCTGTGG - Intergenic
1170727663 20:18943971-18943993 CAGTTTCTTCAAAAGTTCTGTGG + Intergenic
1170740993 20:19056545-19056567 CAGTGCCATCAAAGGGTCTGTGG - Intergenic
1170863298 20:20128565-20128587 TGCTTCCTTCAGAGGGTCTGCGG + Intronic
1171165471 20:22966808-22966830 TGCTTCCTTCAGAGGGTCTGTGG - Intergenic
1171274717 20:23846841-23846863 TAGTTGCTTTACAAGGTCTGTGG - Intergenic
1171375405 20:24690697-24690719 CACCTCCTTCAAAGGGTCTGTGG + Intergenic
1172851502 20:37969469-37969491 CAGTTCCTTTAAAGGGTCTGTGG + Intergenic
1172853928 20:37986664-37986686 CAGGTCCTTCTGAGGCTCTGAGG + Intronic
1176836979 21:13802050-13802072 CAGTTCCTGCAAATGGTGTGGGG + Intergenic
1177127678 21:17216759-17216781 CAGTTCCTTCAAAGGGTCTGTGG - Intergenic
1177847286 21:26305743-26305765 CACTTTCTTCAGAGGGTCTGTGG - Intergenic
1177995486 21:28090659-28090681 CGCTTCCTTCAGAGGGGCTGTGG + Intergenic
1178059241 21:28834266-28834288 TGCTTCCTTCAGAGGGTCTGTGG - Intergenic
1178341128 21:31785968-31785990 CCATTACTTCAGAAGGTCTTGGG + Intergenic
1178801549 21:35800679-35800701 CACTTCCTTCAGAGGGTCTGTGG - Intronic
1179467909 21:41589928-41589950 CCGTTCCTTCAAAGGGTCTGTGG + Intergenic
1181371022 22:22417000-22417022 CCCTTCCTTCAGAGGGTCTGTGG - Intergenic
1181454202 22:23047092-23047114 CACTTCCTTAAGAGGGTCTGTGG - Intergenic
1182349666 22:29692209-29692231 CAGTGCCTTCTGGAGGACTGTGG + Intronic
1182950643 22:34372468-34372490 CACTTCCCTCAGAAGCTCTCTGG - Intergenic
1183048592 22:35241804-35241826 CACTTCCTTCAGAGGGTCTGTGG + Intergenic
1183311778 22:37113711-37113733 TGGTTCCTTCTGAAGGTATGAGG - Intergenic
1183601924 22:38844665-38844687 CTGCTCCTTCAGAAGGTTGGAGG - Intergenic
1183774143 22:39951937-39951959 CAGTTTCTAGAGGAGGTCTGAGG + Intronic
1185293455 22:50040767-50040789 GACTTCTTTCAGAGGGTCTGCGG - Intronic
949189545 3:1235705-1235727 CAGTTCTTTCAAAGGGTTTGTGG - Intronic
949604179 3:5635073-5635095 CGCTTTCTTCAGAGGGTCTGTGG + Intergenic
950019328 3:9775952-9775974 CTGTTGATTCAGTAGGTCTGTGG + Intronic
950599328 3:14017810-14017832 TGCTTCCTTCAGAGGGTCTGTGG + Intronic
950603683 3:14058504-14058526 CACTTCCTCCAGAGGGTCTGTGG + Intronic
950809523 3:15637643-15637665 CAGTGTCATCAGGAGGTCTGAGG - Intronic
951262288 3:20523983-20524005 CACTTCCTTCAAAGAGTCTGTGG + Intergenic
951269485 3:20607631-20607653 TACTTCCTTCAGAGGGTCTGTGG - Intergenic
951431641 3:22614742-22614764 CAATTCCTTCTGATGGTCTTTGG + Intergenic
951572355 3:24077940-24077962 TGCTTCCTTCAGAGGGTCTGCGG + Intergenic
951764187 3:26178878-26178900 CACTTTCTTCAGAGGGTCTGCGG + Intergenic
951818050 3:26777397-26777419 CAGATACTTCAGAAGGTGGGAGG + Intergenic
951966997 3:28398548-28398570 TGGTTCCTTCAGAGGGTCTGTGG - Intronic
952024028 3:29057380-29057402 CACCTCCTTCAAAGGGTCTGTGG - Intergenic
952063411 3:29538293-29538315 AAGTTACTTCAGAACTTCTGTGG - Intronic
952097332 3:29968728-29968750 CGCTTCCTTCAGAGGGTCTGTGG + Intronic
952689815 3:36191881-36191903 CACTTCCTTCAGGGGGTCTGTGG + Intergenic
952703242 3:36348691-36348713 TGCTTCCTTCAAAAGGTCTGTGG - Intergenic
953144921 3:40266376-40266398 CAGATCCTTAAGAAGCTCTTGGG - Intergenic
953276661 3:41507934-41507956 CAGTTCCTTCAAAGGGTCTATGG - Intronic
953284350 3:41592065-41592087 CGCTTCCTTCAGTGGGTCTGTGG - Intronic
953471981 3:43175552-43175574 CAGCTCCTTTAGGAGGACTGAGG - Intergenic
953724091 3:45382272-45382294 CACTTCCCTCAGAGGGTCTGTGG + Intergenic
953866457 3:46587291-46587313 CACTTCCTTGAGAGGGTCTGTGG - Intronic
954404834 3:50339893-50339915 CAGTTGATTCAACAGGTCTGCGG + Intronic
954914034 3:54134211-54134233 CTGTGCCTTCGGCAGGTCTGGGG + Intronic
955450888 3:59065407-59065429 CACTTCCTTCAAAGGGTCTGGGG + Intergenic
955461754 3:59190381-59190403 TGCTTCCTTCAGAGGGTCTGTGG + Intergenic
955684937 3:61540062-61540084 CAATTACATCAGAAGCTCTGGGG - Intergenic
956950131 3:74273418-74273440 CACTTCCTTCAGAGGGTCTGTGG - Intronic
956996472 3:74831511-74831533 GACTTCCTTTAGAGGGTCTGTGG + Intergenic
957383361 3:79463413-79463435 CAGTTGCTTGAAAAGGTTTGTGG - Intronic
958013674 3:87913984-87914006 CGCTTCCTTCAGGGGGTCTGTGG - Intergenic
958151433 3:89698964-89698986 CGCTTCTTTCAGAGGGTCTGTGG - Intergenic
958263040 3:91404435-91404457 CGCTTCCTTCAGAGAGTCTGAGG + Intergenic
958480897 3:94644049-94644071 CATTTCCTTCAGAGGATTTGTGG + Intergenic
958770547 3:98421236-98421258 TACTTCCTTCAGAGGGTCTGTGG - Intergenic
958776053 3:98483866-98483888 TACTTCTTTCAAAAGGTCTGTGG + Intergenic
958970080 3:100601348-100601370 TGCTTCCTTCAGAGGGTCTGTGG + Intergenic
959046851 3:101484490-101484512 CACATCCTTTAGAGGGTCTGTGG - Intronic
959275358 3:104270352-104270374 CACTTCCTTCAGAGGGTCTGTGG + Intergenic
959361691 3:105402382-105402404 CAGTTCCTTCAAAGGGTCTGTGG - Intronic
959390715 3:105770221-105770243 CAATTCTTTCACAGGGTCTGTGG - Intronic
959597611 3:108145074-108145096 CATCTCCTTCAGAAAGTCTTTGG - Intergenic
959757095 3:109911539-109911561 TGCTTCCTTCAGAAGGTCTGTGG + Intergenic
959802639 3:110513040-110513062 CACTTCCTTCAGAGGATCTGTGG + Intergenic
959898986 3:111639145-111639167 TGCTTCCTTCAGAGGGTCTGTGG - Intronic
959997135 3:112692736-112692758 CACTTCCTTCAGAGGGTCTGTGG - Intergenic
960064295 3:113354292-113354314 CAGTTCCTTCAAAGGGTCTGTGG - Intronic
960513042 3:118572686-118572708 CACTTCCTTCAGAGGGTCTGTGG + Intergenic
960516418 3:118607595-118607617 CACTTCCTTCAGAGGGTGTGTGG - Intergenic
960555937 3:119030727-119030749 CAGATCCTCCAGATGGTGTGGGG + Intronic
960665683 3:120106707-120106729 CAGTACACTCAGAAGGTATGGGG + Intergenic
960756398 3:121018869-121018891 CACCTCCTTCAAAGGGTCTGTGG - Intronic
961968020 3:130926119-130926141 CAATTTCTTCAAAGGGTCTGTGG + Intronic
962034396 3:131636134-131636156 CAGTTCCTTCAAAGGGTCTGTGG - Intronic
962066128 3:131981955-131981977 CCCTTTCTTCAGAGGGTCTGTGG + Intronic
962504904 3:136036640-136036662 CGCTTCCTTCAGGGGGTCTGTGG + Intronic
962709358 3:138072666-138072688 CAGTTCCTTTACAGGGTCTATGG - Intronic
962984108 3:140518687-140518709 CACTTCCTTCAAAGGGTCTGTGG + Intronic
962990536 3:140573539-140573561 AAGTTCCTTTCAAAGGTCTGTGG - Exonic
963047680 3:141115015-141115037 GAGTTCCTTCATAGGGTGTGAGG + Intronic
963071842 3:141311266-141311288 CAGTTCATTCAGAAGGGTTTTGG - Intergenic
963373933 3:144438398-144438420 CAGTTCCTTCAGAGGGTCTGTGG + Intergenic
963829315 3:149990150-149990172 CAATTCAATCAGAATGTCTGGGG + Intronic
963832412 3:150022638-150022660 CAGTTCCTTCAAACTGTCTGTGG - Intronic
964160506 3:153640351-153640373 CACATCCTTCAGAAGGTCTGTGG - Intergenic
964188868 3:153979686-153979708 TGCTTCCTTCAGAGGGTCTGTGG - Intergenic
964226398 3:154408323-154408345 CAATTCCTTCAGTGGGTCTGTGG - Intronic
964299289 3:155270721-155270743 CAGTTCTTTCAAAGAGTCTGTGG - Intergenic
964393100 3:156217995-156218017 CTGTTCTTTCAGAGCGTCTGTGG - Intronic
964769569 3:160210319-160210341 CAATTCCTGCAGCAGGTTTGTGG - Intergenic
964794003 3:160478487-160478509 CAGTTTCTTCAAAGGGTCTGTGG - Intronic
965052825 3:163671980-163672002 TACTTCCTTCAGAAGTTCTATGG + Intergenic
965101530 3:164305654-164305676 TAGTTGCTTCAAATGGTCTGTGG - Intergenic
965217021 3:165875577-165875599 TGCTTCCTTCAGAGGGTCTGTGG + Intergenic
965614507 3:170579779-170579801 CATTTCCTTCAGAAAGTATTTGG - Intronic
966117806 3:176485852-176485874 CACGTCCTTCAGAGGGTCTGTGG + Intergenic
966122288 3:176536349-176536371 CACTTCCTTCGGAGGGTCTGTGG - Intergenic
966229974 3:177641070-177641092 CAGTTCCTTCAGAGGGTCTGTGG + Intergenic
966586517 3:181632526-181632548 AAGTACCTTTAAAAGGTCTGAGG + Intergenic
966686771 3:182703852-182703874 TGCTTCCTTCAGAGGGTCTGTGG + Intergenic
966992144 3:185243241-185243263 TGCTTCCTTCAGAGGGTCTGTGG + Intronic
967257647 3:187609712-187609734 GGCTTCCTTCAGAGGGTCTGTGG + Intergenic
967399811 3:189048751-189048773 CGCTTCCTTCAGAGGGTCTGTGG - Intronic
967434594 3:189430225-189430247 CACTTCTTTCAAAGGGTCTGTGG - Intergenic
967651211 3:191989608-191989630 CATTTCCTTCAGAGGGTCTGTGG - Intergenic
969165615 4:5308254-5308276 CACTTCCTTGAAAAGGTCTGTGG + Intronic
970346716 4:15159473-15159495 CACTTTCTTCAGAGAGTCTGTGG + Intergenic
970658753 4:18260922-18260944 TGCTTCCTTCAGAAGGTCTATGG + Intergenic
971035605 4:22689608-22689630 CAGTACCTTCAGAAGGTGGCAGG + Intergenic
971050462 4:22855835-22855857 CAGTTCCTTCAAAGGGTTTGTGG + Intergenic
971183267 4:24350170-24350192 TGCTTCCTTCAGAGGGTCTGTGG + Intergenic
971555009 4:28002443-28002465 TAGTTCCTTCAAAGGGTCTGTGG + Intergenic
972018881 4:34282228-34282250 CACTTCTTTCAAAGGGTCTGTGG + Intergenic
972033110 4:34487603-34487625 CAGTTCCTTCACAGTGTTTGAGG + Intergenic
972097438 4:35365120-35365142 TGCTTCCTTCAGAGGGTCTGTGG + Intergenic
972209688 4:36822808-36822830 CACTTCTTTCAAAGGGTCTGTGG - Intergenic
972771747 4:42203668-42203690 CAGGTCCTACTGAAGGGCTGAGG + Intergenic
973179733 4:47252397-47252419 TGCTTCCTTCAGAGGGTCTGTGG + Intronic
973343108 4:49026346-49026368 CACTTCCTTCAAAGGGTCTGTGG + Intronic
973782266 4:54300043-54300065 CACTTCCATCAGAGGGTCTGTGG - Intergenic
973786950 4:54341460-54341482 CACCTCTTTCAGAGGGTCTGTGG - Intergenic
973831578 4:54764878-54764900 CACTTCCTTCAGGTGGTCTGTGG + Intergenic
974164965 4:58190519-58190541 TACTTCCTTCAGAGAGTCTGTGG - Intergenic
974638963 4:64604892-64604914 TAGTTGCTTTATAAGGTCTGTGG + Intergenic
974801940 4:66828850-66828872 CACCTCCTTCAAAGGGTCTGTGG + Intergenic
975203043 4:71614484-71614506 CAGTTCCTTCAAAGCGTTTGTGG - Intergenic
975365259 4:73521227-73521249 CAGTTCCTTTAAAGGGTTTGTGG + Intergenic
975680064 4:76867655-76867677 CACTTCTGTCAGAGGGTCTGTGG - Intergenic
975695945 4:77013079-77013101 TACTTCCTTCAGAATGTCTGTGG - Intronic
975790474 4:77944307-77944329 CACTTCCTTCAAAGGGTCTGTGG + Intronic
975814966 4:78208010-78208032 CACTTCCTTCAGAGGGTATGTGG - Intronic
975942760 4:79668026-79668048 CAGTTCCTTCAAAGGGTCTGTGG - Intergenic
976686467 4:87820138-87820160 CACGTCCTTCAGAGGGTCTGTGG + Intergenic
976791135 4:88880192-88880214 CACTTCCTTCAAAGGGTCTGTGG - Intronic
976963248 4:91004101-91004123 CACTTCCTTCGGAGAGTCTGTGG + Intronic
977020133 4:91747620-91747642 CACTTCCTTCAGAGGGTCTGTGG + Intergenic
977489196 4:97691159-97691181 CACCTCCTTCAAAGGGTCTGTGG - Intronic
977733097 4:100379256-100379278 CACTTCCTTCATAGGGTCTGTGG - Intergenic
977746657 4:100558001-100558023 TGCTTCCTTCAGAGGGTCTGTGG - Intronic
977777475 4:100938620-100938642 CAGCTCCTTCAAAGGGTCTGTGG - Intergenic
977813834 4:101390162-101390184 TGCTTCCTTCAGAGGGTCTGAGG + Intergenic
977852619 4:101848238-101848260 CGCTTCCTCCAGAGGGTCTGTGG + Intronic
977976174 4:103269179-103269201 CAGTTCCTTCAAAGGGTCCATGG + Intergenic
978653155 4:111032501-111032523 CATTTACTTCAGTAGGTCTGTGG + Intergenic
978670556 4:111243741-111243763 TTCTTCCTTCAGAGGGTCTGTGG - Intergenic
978726838 4:111978355-111978377 TCCTTCCTTCAGAGGGTCTGTGG + Intergenic
978761780 4:112361203-112361225 CACCTCCTTCAAAGGGTCTGTGG - Intronic
979030224 4:115633791-115633813 CAGTTCCTTCAAAAGGTCTGTGG + Intergenic
979195737 4:117917590-117917612 TACTTCCTTCAAAGGGTCTGTGG + Intergenic
979543279 4:121910949-121910971 CAGTTTCTTCAGAATGTCCTAGG - Intronic
979957113 4:126967961-126967983 CAGATCCTTTGGAAGGGCTGTGG - Intergenic
980263208 4:130481455-130481477 CACTTCCTTCGGAGGGTCTGTGG - Intergenic
980645027 4:135632952-135632974 CAGTTCCTTCAAAGGGTCTGTGG + Intergenic
980761488 4:137239246-137239268 CAGTTCCTTCAAAGGGTCTGTGG + Intergenic
981010807 4:139922918-139922940 CTGTTCCTTCAAAGGGTTTGAGG + Intronic
981167572 4:141580504-141580526 CAGTTCCTTCAAAGCGCCTGTGG - Intergenic
981177965 4:141703654-141703676 CACTTCTTTCAAAAGGTCTGTGG + Intronic
981376667 4:144024440-144024462 CACTTCCTTCAGAGGGTCTGTGG - Intergenic
981387170 4:144145786-144145808 CACTTCCTTCAGAGGGTCTGTGG - Intergenic
981760934 4:148193358-148193380 CGCTTCCTTCAGAGGGTCTGTGG + Intronic
981796521 4:148601131-148601153 CACCTCCGTCAGAGGGTCTGTGG + Intergenic
982190067 4:152844295-152844317 CGCTTCCTTCAGAGGGTCTGTGG + Intronic
982312283 4:153998070-153998092 TGCTTCCTTCAGAAGGTCTGTGG + Intergenic
982332671 4:154198913-154198935 TAGTTGCTTTATAAGGTCTGTGG + Intergenic
982680286 4:158419745-158419767 TGCTTCCTTCAGAGGGTCTGTGG + Intronic
982829347 4:160041929-160041951 CACTTCCTACAAAGGGTCTGTGG - Intergenic
982960435 4:161828337-161828359 CACTTCCTTCAAAGAGTCTGTGG + Intronic
982991758 4:162285778-162285800 CAGTTCCTTCAAAGGGTCTGTGG - Intergenic
982994454 4:162323379-162323401 CAGCTCCTTCATAGGGTATGTGG + Intergenic
983251621 4:165352100-165352122 CAGTTCTTTCAAAGGGTCTGTGG + Intergenic
983297893 4:165889984-165890006 CAGTTCATTCAGTATGGCTGGGG + Intronic
983434335 4:167692974-167692996 CAGTTCCTTCTGAACTTCTTGGG + Intergenic
983449637 4:167894743-167894765 CGCTTCCTTCAGAGGGTCTGTGG - Intergenic
983729946 4:170980003-170980025 CACCTCCTTCAAAGGGTCTGTGG + Intergenic
984234227 4:177137009-177137031 CAGTTCTTTCAAAGGGTCTATGG - Intergenic
984266839 4:177506122-177506144 CGCTTCCTTCATAGGGTCTGTGG + Intergenic
984475109 4:180225419-180225441 TGCTTCCTTCAGAGGGTCTGTGG + Intergenic
984787082 4:183577403-183577425 CAGGTCCTTCAGGAGGTATCCGG + Intergenic
985092729 4:186381247-186381269 CACTTCCTTCAGAGGGTCTGCGG - Intergenic
985217926 4:187672600-187672622 CACTTCCTTCAGAGGGTCTGCGG + Intergenic
985240944 4:187930111-187930133 CACTTCCCTCAGAGGGTCTATGG + Intergenic
985753093 5:1694068-1694090 CAGATCCTCCAGAAGGTCTGAGG - Intergenic
986633927 5:9801527-9801549 CCTTTCCTTCAAAGGGTCTGTGG - Intergenic
986644599 5:9904168-9904190 CACCTCCTTCAAAGGGTCTGTGG + Intergenic
986870124 5:12036163-12036185 CACTTCCTTCAAAAGGTCTGTGG - Intergenic
987414306 5:17647235-17647257 CACTTCCTTTAGAGGGTCTGTGG + Intergenic
987436958 5:17906211-17906233 CACCTCTTTCAGAGGGTCTGTGG + Intergenic
987594493 5:19979375-19979397 CAGTTTCAGCAGAAGGTCTGAGG - Intronic
987704352 5:21444098-21444120 CCCTTCCTTCATAGGGTCTGTGG + Intergenic
987846753 5:23296447-23296469 CAGTTCCTTCAAAGAGTCTGTGG + Intergenic
988018127 5:25586516-25586538 CGCTGCCTTCAAAAGGTCTGTGG + Intergenic
988344477 5:30020393-30020415 CACTTCCTTCAGAATTTTTGTGG - Intergenic
988421251 5:31008434-31008456 CAGTTCCTTCAAAGGATCTGTGG + Intergenic
988712726 5:33794302-33794324 CGCTTCCTTCAGAGGGTCTGTGG + Intronic
988723691 5:33904036-33904058 TGCTTCCTTCAGAGGGTCTGTGG + Intergenic
989431610 5:41361398-41361420 CAGTTTCTTCATATAGTCTGTGG + Intronic
989538578 5:42592084-42592106 CAGTTCCTTCAAAGGGTCTGTGG + Intronic
990137806 5:52668553-52668575 CGCTTCCTTCAGAGGATCTGTGG - Intergenic
990572647 5:57094701-57094723 TGCTTCCTTCAGGAGGTCTGTGG - Intergenic
990899696 5:60737286-60737308 CACTTCCTTCAGAGGGTTTGTGG + Intergenic
990918645 5:60937781-60937803 CACTTCCTTCAAAGGGTCTGTGG + Intronic
991386809 5:66100452-66100474 TGCTTCCTTCAGAGGGTCTGTGG - Intergenic
992055077 5:72981022-72981044 CAGTTTCTTCATAATGTCGGTGG + Intronic
993250423 5:85513749-85513771 CCCTTCCTTCAGAGGGTCTGTGG + Intergenic
993742889 5:91562392-91562414 CATTTCCTTCAAAGGGTCTGCGG - Intergenic
993820895 5:92615334-92615356 CAGTTCCTTGAGAGGTTCTAGGG - Intergenic
993884005 5:93395454-93395476 TGCTTCCTTCAGAGGGTCTGCGG + Intergenic
993920566 5:93795447-93795469 CAGTTCCTTCAGAGGGTCTGTGG + Intronic
994222315 5:97209393-97209415 TGCTTCCTTCAGAGGGTCTGTGG + Intergenic
994303937 5:98180044-98180066 TGCTTCCTTCAGAGGGTCTGTGG - Intergenic
994871122 5:105351349-105351371 CACTTCCTTCAAAGGGTCTATGG + Intergenic
994908444 5:105869581-105869603 CACTTCTTTCAAAGGGTCTGTGG + Intergenic
995421837 5:111976480-111976502 CAGTACCTTCAGCAGTGCTGAGG + Intronic
995474351 5:112532735-112532757 CACTTCCTTCGGAGGGTCTGTGG + Intergenic
995727427 5:115196171-115196193 CACTTTCTTCAGATGTTCTGTGG - Intergenic
996010622 5:118478457-118478479 CACTTCCTTCAGAGGGTCTGTGG - Intergenic
996080677 5:119255311-119255333 CACTTCCTTCAAAGGGTCTGTGG - Intergenic
996128398 5:119752649-119752671 CACTTCCTTCAGAGGGTCTGTGG - Intergenic
996325292 5:122266826-122266848 TGCTTCCTTCAGAGGGTCTGTGG - Intergenic
996397363 5:123026778-123026800 CAGATCCTTCTTATGGTCTGTGG - Intronic
996615826 5:125440636-125440658 CACTTCCTTCAAAGGATCTGTGG - Intergenic
996875428 5:128235476-128235498 CAATTCCTTCGAAGGGTCTGTGG + Intergenic
996985362 5:129555748-129555770 CAGTACAGTCAGAAGATCTGAGG - Intronic
997231155 5:132244009-132244031 CAGTTCCTTCAAAGGGTCTGTGG + Intronic
997760788 5:136445860-136445882 CACTTCCTTCAGAGGGTCTGTGG - Intergenic
997798393 5:136834433-136834455 CAGTTCCCTCAAAGGGTCTGCGG + Intergenic
998164269 5:139833775-139833797 CAGTACCTTCAGCAGGTCTTTGG - Exonic
998850951 5:146350183-146350205 CAGCCCCATCAGTAGGTCTGGGG + Intergenic
998940709 5:147279873-147279895 CGTTTCCTTCAGAGAGTCTGTGG - Intronic
999478974 5:151927449-151927471 CAGTTGCTTCAGAAGTTCAGTGG + Intergenic
999491144 5:152052731-152052753 CCCTTCCTTCAGAGGGTCTGTGG + Intergenic
999676968 5:154014413-154014435 CACTTCCTTCAGAGGGTATATGG - Intronic
999682443 5:154072775-154072797 CAGTTCCTGCAGAAAGCCGGCGG + Intronic
1000193185 5:158933000-158933022 AAGTGGCTTCAGAAGTTCTGAGG - Intronic
1000779522 5:165464313-165464335 CACTTCCTTCAGAGGGTCTGTGG - Intergenic
1000982274 5:167828509-167828531 CAGTTACTTCAACAGGGCTGAGG - Intronic
1001166477 5:169373834-169373856 CCATTTCTTCAGAGGGTCTGTGG - Intergenic
1001177270 5:169481639-169481661 TGCTTCCTTCAGAGGGTCTGTGG + Intergenic
1001290739 5:170457409-170457431 CACTTCCTTCAGAGGGTCTGTGG - Intronic
1002180416 5:177428274-177428296 CAGTGCCATCAGCAGGCCTGAGG - Intronic
1003029579 6:2589970-2589992 CACTTCCTTCAGAGGGTCTGTGG + Intergenic
1003552451 6:7110400-7110422 CCATTCCTTCAGAAGTTCTGTGG - Intronic
1003581796 6:7347204-7347226 CGCTTCCTTCAGAGGGCCTGTGG - Intronic
1003712056 6:8603081-8603103 CACTTCCTTCAGAGGGTCTGTGG + Intergenic
1004111885 6:12726718-12726740 GATTTGCTTCAGAAGGACTGGGG + Intronic
1004600604 6:17145838-17145860 CGCTTCCTTCAGAGGATCTGTGG + Intergenic
1004888478 6:20074539-20074561 CAGTTCCTTCAAAGGGTCTGTGG - Intergenic
1005072369 6:21873940-21873962 CACTTCCTTCAGAGGGTCTGTGG - Intergenic
1005191562 6:23229204-23229226 CACTTCCCTCAAAGGGTCTGTGG + Intergenic
1005244063 6:23861810-23861832 CACTTCCTTCAAAGGGTCTGTGG - Intergenic
1007020469 6:38515185-38515207 CAGTTCATATAGAAAGTCTGTGG - Intronic
1008042340 6:46815586-46815608 CAGTTCCTTCAAAGGGTCTATGG + Intronic
1008115505 6:47545274-47545296 TGCTTCCTTCAGAGGGTCTGTGG - Intronic
1008208872 6:48696155-48696177 TAGTTGCTTCATAATGTCTGTGG - Intergenic
1008256119 6:49302767-49302789 CACTTCCTTCAGAGGGACTGTGG - Intergenic
1008402370 6:51078511-51078533 CAGTTCCTTCAAAGGGTCTGTGG + Intergenic
1008511397 6:52279061-52279083 CAGTTCTGTCTGAAGTTCTGTGG - Intronic
1008528763 6:52434561-52434583 TGCTTCCTTCAGAGGGTCTGTGG + Intronic
1008679559 6:53857619-53857641 CAGCACATTCAGAAGGGCTGTGG + Intronic
1008775536 6:55032703-55032725 TGCTTCCTTCAGAGGGTCTGTGG + Intergenic
1008992367 6:57618453-57618475 CGCTTCCTTCAGAGAGTCTGAGG - Intronic
1009180991 6:60517565-60517587 CGCTTCCTTCAGAGAGTCTGAGG - Intergenic
1009384250 6:63069361-63069383 CACTTCCTTCAGAGGACCTGTGG + Intergenic
1009453030 6:63824507-63824529 CACTTCCTTCAGAGGGTCTGTGG - Intronic
1009493729 6:64325141-64325163 CACTTCCTTCAGAGGGTCTGTGG - Intronic
1009800328 6:68528404-68528426 CACTTCCTTCAAAGGGTCTGTGG + Intergenic
1009866861 6:69408826-69408848 CAGTTTCTTCAAAGGTTCTGTGG - Intergenic
1010009088 6:71028923-71028945 CGCTTCCTTCAAAGGGTCTGTGG + Intergenic
1010076503 6:71804088-71804110 CTCTTCCTTTAGAGGGTCTGTGG + Intergenic
1010165244 6:72906776-72906798 CACTTCCTTCAGAGGGTCTGTGG + Intronic
1010500409 6:76593365-76593387 CACTTCCTTCTAAGGGTCTGTGG - Intergenic
1010707883 6:79135745-79135767 TGCTTCCTTCAGAGGGTCTGTGG + Intergenic
1010790995 6:80065145-80065167 CACTTCCTTCAGAATTTCTCCGG + Intergenic
1011133285 6:84073462-84073484 TGCTTCCTTCAGAGGGTCTGTGG + Intronic
1011168495 6:84478773-84478795 TGCTTCCTTCAGAGGGTCTGTGG - Intergenic
1011225088 6:85096585-85096607 CACTTCCTTCAAAGGGTCTGTGG - Intergenic
1011233198 6:85187237-85187259 TGCTTCCTTCAGAGGGTCTGTGG - Intergenic
1011789876 6:90886182-90886204 TGCTTCCTTCAGAGGGTCTGTGG + Intergenic
1011817949 6:91214218-91214240 CACTTCCTTCAAAGGGTCTTTGG + Intergenic
1011833602 6:91403804-91403826 CACTTCCTTCAGAGGGTCTATGG - Intergenic
1011965926 6:93157101-93157123 CAGTTCCATCAAAGTGTCTGTGG + Intergenic
1012155832 6:95819234-95819256 TGCTTCCTTCAGAGGGTCTGTGG - Intergenic
1012581211 6:100872604-100872626 TGCTTCCTTCAGAAGGTCTGTGG - Intronic
1012793612 6:103733655-103733677 CACTTCCTTCAGAGGGTCTGTGG - Intergenic
1012806746 6:103904008-103904030 CACTTCCTTCAGAGGGTCTGTGG + Intergenic
1013494841 6:110688505-110688527 CACTTCTTTCAAAGGGTCTGTGG - Intronic
1013590810 6:111618382-111618404 CAGTTCCTTGAGAGTCTCTGGGG - Intergenic
1013676460 6:112468629-112468651 CACTTACATCAGAATGTCTGAGG + Intergenic
1013852764 6:114535309-114535331 TGCTTCCTTCAGAGGGTCTGTGG + Intergenic
1013867567 6:114717463-114717485 AAGTTTCTTCAGAAGGTGTCTGG + Intergenic
1013901122 6:115156884-115156906 CACTTCCTTCAGAGGGTCTGTGG + Intergenic
1014304948 6:119728191-119728213 TGCTTCCTTCAGAGGGTCTGTGG + Intergenic
1014420342 6:121235741-121235763 CAGTTCCTTCAAAGGTTCTGTGG + Intronic
1014482095 6:121951316-121951338 CCGTTCCTTCAAAGGGTCTGTGG + Intergenic
1014531495 6:122564218-122564240 CACTTCCTTTAGAGGATCTGTGG + Intronic
1014603766 6:123447849-123447871 TGCTTCCTTCAGAGGGTCTGTGG - Intronic
1014738636 6:125123719-125123741 CACTTCCTTCAGAGGGTCTGCGG - Intronic
1014868435 6:126560512-126560534 CAGTTCCTTCATAGTGTCTATGG - Intergenic
1015222190 6:130816978-130817000 TGCTTCCTTCAGAGGGTCTGTGG - Intergenic
1015663411 6:135601014-135601036 CGTTTCCTTCAGAAGGTCTGTGG + Intergenic
1015849936 6:137560857-137560879 CACTTCCTTCAGAGGGTCTGTGG + Intergenic
1016290145 6:142519304-142519326 CACTTCCTTCAGAGGATCTGTGG + Intergenic
1016384827 6:143520366-143520388 CACTTCCTTCAGAGGGTCTGTGG - Intergenic
1017045841 6:150346467-150346489 AAGTTACTTCAGGAGGTTTGGGG - Intergenic
1017125273 6:151058975-151058997 CATTTCCTTTAGAAGCTCTGTGG - Intronic
1017190621 6:151649071-151649093 CGCTTCCTTCAGAGGGTCTGTGG + Intergenic
1017571623 6:155750602-155750624 CAGTTTCTTCATAGTGTCTGTGG - Intergenic
1018755223 6:166842896-166842918 AAGTTCCTTCAAAGGGTCCGTGG - Intronic
1019881128 7:3862245-3862267 CAATTACATCAGAATGTCTGGGG + Intronic
1020358695 7:7304171-7304193 CGCTTCCTTCAGAGGGTCTGTGG + Intergenic
1020377716 7:7507007-7507029 CAGTTAAATCAGAATGTCTGGGG - Intronic
1021081376 7:16369822-16369844 CACTTCTTTCAAAGGGTCTGTGG - Intronic
1021979833 7:26043697-26043719 CACTTCCTTCAGAGAGTTTGTGG + Intergenic
1022026255 7:26450429-26450451 CAGTTACTTCAGTTGTTCTGTGG + Intergenic
1022339617 7:29455987-29456009 GAGTTCATTCTGCAGGTCTGAGG + Intronic
1022822049 7:33971726-33971748 CAATTCCATCAGAATCTCTGAGG + Intronic
1023145401 7:37146086-37146108 CAGTTCAATGAGAAGCTCTGTGG + Intronic
1023158998 7:37279445-37279467 TGCTTCCTTCAGAGGGTCTGTGG - Intronic
1023657659 7:42441261-42441283 CAGTTCCTTCAAAGGGTCTGTGG + Intergenic
1023701124 7:42892883-42892905 TACTTCCTTCAGAGGGTCTGTGG - Intergenic
1024365422 7:48515146-48515168 CAGTGCCTGCAAAATGTCTGAGG - Intronic
1024367358 7:48536006-48536028 CAGTTCCTTCAAAGGGTCTGTGG + Intronic
1024455646 7:49604316-49604338 CACTTCCTTCAAAGGGTCTGTGG - Intergenic
1024545346 7:50513091-50513113 CACTTCCTTCACAGAGTCTGTGG - Intronic
1024549713 7:50552563-50552585 CAGGTCAATCAGGAGGTCTGAGG - Intronic
1024745494 7:52400659-52400681 CACTTCCTTCAGAGGGTCTGTGG + Intergenic
1024839911 7:53574239-53574261 CACTTCCTTCAGAGGGTCTGTGG - Intergenic
1024917357 7:54515918-54515940 TGCTTCCTTCAGAGGGTCTGTGG + Intergenic
1025155682 7:56604247-56604269 CCATTCCTGCAGAAGTTCTGTGG + Intergenic
1025794886 7:64730071-64730093 CACTTTCTTCAGAGGGTCTGTGG + Intergenic
1025820522 7:64958762-64958784 TGCTTCCTTCAGAAAGTCTGTGG - Intergenic
1025924554 7:65946501-65946523 CTGTTCCTTCAGTGGGTCTGTGG - Intronic
1025931874 7:66001730-66001752 CTTTTCCTTCAGTGGGTCTGTGG - Intergenic
1026553664 7:71388351-71388373 GATTTCCTTCAGCAGGTGTGTGG - Exonic
1027295247 7:76763500-76763522 CGCTTCCTTCAGAGGGTCTGTGG - Intergenic
1027328989 7:77071410-77071432 TGCTTCCTTCAGAGGGTCTGTGG + Intergenic
1027350592 7:77307072-77307094 TGCTTCCTTCAGAGGGTCTGTGG + Intronic
1027754752 7:82198515-82198537 CACTTAATTCAGAATGTCTGAGG + Intronic
1028183106 7:87748364-87748386 CCACTCCTTCAGAGGGTCTGTGG + Intronic
1028197692 7:87926563-87926585 CAGTTCCTTCAAAAGGTCTGTGG - Intergenic
1028261625 7:88673856-88673878 CACCTCCTTCAAAGGGTCTGTGG - Intergenic
1028307398 7:89282853-89282875 CGCTTCCTTCAGAGGGTCTAGGG - Intronic
1028501785 7:91527345-91527367 CAGTTCCTTCAAAGGGTCTCTGG - Intergenic
1028529767 7:91825368-91825390 CACTTCCTTCAAAGGGTCTGTGG + Intronic
1028734347 7:94190394-94190416 TAGTTCCTCCAGAAGGCCTTAGG - Intergenic
1028761854 7:94506263-94506285 CTGTTCCTTCAGAAGTTTGGTGG + Intergenic
1028822514 7:95229262-95229284 CAGTTCCTTCAAAAGGTCTGTGG - Intronic
1028962291 7:96762124-96762146 TGCTTCCTTCAGAAGGTCTGTGG + Intergenic
1029052978 7:97708971-97708993 CACTTCCTTCAGAGGGTCTGTGG - Intergenic
1029786782 7:102799968-102799990 TGCTTCCTTCAGAGGGTCTGTGG - Intronic
1030097205 7:105910864-105910886 TTGTGCCTTCAGTAGGTCTGTGG + Intronic
1030533409 7:110737173-110737195 CAGTTCCTTCAAAGGGTCTGTGG - Intronic
1030935856 7:115584662-115584684 CACTTCCTTCAGAGGGTCTGTGG - Intergenic
1031147805 7:118016599-118016621 CGCTTCCTTCAGAGGGTCTGGGG - Intergenic
1031655521 7:124349865-124349887 CAGTTCCTTCAAATGGCCTGTGG + Intergenic
1031739981 7:125418072-125418094 TGCTTCCTTCAGAGGGTCTGTGG - Intergenic
1031879091 7:127176588-127176610 CACTTCCTTCAGAGGGTCTGTGG - Intronic
1032448970 7:132010228-132010250 CAGTTCCTTCAAAGGGTCTGTGG + Intergenic
1032830361 7:135618839-135618861 CACTACATTCAGTAGGTCTGGGG - Intronic
1033259277 7:139828483-139828505 TGGTTCCTTCAGAGAGTCTGTGG + Intronic
1033259711 7:139832100-139832122 CGCTTCCTTCAGAGGGTCTGTGG - Intronic
1033815805 7:145071021-145071043 CACTTTCTTCAGAAGGTCCCAGG - Intergenic
1034683329 7:152947705-152947727 CACTTCCTTCAGAGGGTCTGTGG + Intergenic
1034975560 7:155447573-155447595 CAGTCCCTTTAGCAGGACTGGGG + Intergenic
1035279624 7:157769563-157769585 CAAGGCCTGCAGAAGGTCTGGGG - Intronic
1035591558 8:818504-818526 TAGTTCCTTCCAAGGGTCTGTGG + Intergenic
1035833742 8:2727090-2727112 CACTTCCTTCAGAGGGTCTGTGG - Intergenic
1037671623 8:21020008-21020030 CACTACCTTCAAAAGGTCTGTGG - Intergenic
1038367343 8:26949124-26949146 CACTTCCTTCAGAGGGTCTGAGG + Intergenic
1038908699 8:31937512-31937534 CAGTTCCCTCAAAGGGTCTGTGG - Intronic
1039029997 8:33298938-33298960 CACTTCTTTCAAAGGGTCTGTGG - Intergenic
1039095672 8:33881587-33881609 TGCTTCCTTCAGAGGGTCTGTGG + Intergenic
1039123437 8:34174953-34174975 CACTTCCTTTAGAGGGTCTGTGG - Intergenic
1039571690 8:38592320-38592342 CACTTCCTTCAGGGGGTCTGTGG - Intergenic
1039606889 8:38888304-38888326 TAGTTCATCCAGGAGGTCTGGGG - Intergenic
1039641353 8:39227118-39227140 CACTTCCTTTAGAGGGTCTGTGG - Intronic
1040019781 8:42730655-42730677 AAGTTCCATCAGAATCTCTGTGG + Exonic
1040276454 8:46016441-46016463 CAGCTCCTGCACAGGGTCTGTGG - Intergenic
1040442810 8:47462339-47462361 TGCTTCCTTCAGAGGGTCTGTGG + Intronic
1040635804 8:49271167-49271189 CACTACTTTCAGAGGGTCTGTGG + Intergenic
1040711662 8:50195808-50195830 CACTTCCTTCAGAGGGTCTGTGG + Intronic
1041364037 8:57082923-57082945 CACTTCCTGCAGAGGGTCTGTGG - Intergenic
1041570699 8:59333802-59333824 CACTTCCTTCAGAGGGTCTGTGG + Intergenic
1041658122 8:60374769-60374791 CGCTTCCTTCAGAGGGTCTGTGG - Intergenic
1041831986 8:62164626-62164648 CAGTTCCTTCAAAGGGTCCGTGG - Intergenic
1041927141 8:63248587-63248609 CACATCCTTCAGAGGGTCTGTGG + Intergenic
1041983396 8:63890613-63890635 TTGTTCCTTCAGAAGTTCTCTGG - Intergenic
1042123012 8:65508097-65508119 TGCTTCCTTCAGAGGGTCTGTGG + Intergenic
1042160626 8:65890669-65890691 CATTTCCTTCAAAGGATCTGTGG - Intergenic
1042304273 8:67314663-67314685 CACTTCCTTCAGAGGGTCTGTGG + Intronic
1042431340 8:68710234-68710256 CATTTCCTTCAAATAGTCTGTGG - Intronic
1042467275 8:69141525-69141547 CACTTCCTTCAGAGGGTCTGTGG + Intergenic
1042645592 8:70982681-70982703 CAGTTCCTACAAAGGGTCTGTGG + Intergenic
1042775795 8:72429473-72429495 CAGTTCCTTCTGAGGCTGTGAGG - Intergenic
1043040659 8:75258946-75258968 TGCTTCCTTCAGAGGGTCTGTGG - Intergenic
1043047927 8:75351703-75351725 CACTTCCTTCAGGGGGTCTGTGG - Intergenic
1043071663 8:75643390-75643412 CACTTCCTTCAGACAGTCTGTGG + Intergenic
1043121630 8:76332425-76332447 TGTTTCCTTCAGAGGGTCTGTGG + Intergenic
1043205883 8:77438492-77438514 CAGTTCCTTCAGAGGATCTGTGG + Intergenic
1043545059 8:81306330-81306352 CAGTACCTTCAAAGGGTCTGTGG - Intergenic
1043556818 8:81439590-81439612 CAGTTCCTTCAAAGGGTCTGTGG + Intergenic
1043876489 8:85492000-85492022 CAGTTCCTTCAGAGGGTCTGTGG + Intergenic
1043987758 8:86714644-86714666 TAGTTCCTTCAAAGGGTCTGTGG - Intronic
1044145569 8:88709669-88709691 CAGTACCTTCAGAAGGATTAGGG - Intergenic
1044788248 8:95819134-95819156 CACTTTCTTCAGAGGGTCTGTGG + Intergenic
1044877948 8:96691157-96691179 CTGTTCCTTCAGAGGTTCTAGGG + Intronic
1044880798 8:96719966-96719988 CACTTCATTCAAAGGGTCTGTGG + Intronic
1044903279 8:96972000-96972022 CAGTTCCTTCAAAGGGTCTGTGG - Intronic
1044947966 8:97408404-97408426 CAGTTCCTTCAAAGGGTCTGTGG + Intergenic
1045036127 8:98177926-98177948 CAGTTCGTGCAGAAGCCCTGCGG + Intergenic
1045137590 8:99238021-99238043 CAGTTCCTTCCTTAGGTTTGTGG + Intronic
1045521227 8:102904845-102904867 CAGTTACTTCAGTAGGTCCAGGG - Intronic
1045779698 8:105849089-105849111 CATTTCCTTCAAAGGGTCTGTGG - Intergenic
1045814337 8:106261816-106261838 CAGTTCCTTCAAAGGGTCTGTGG + Intergenic
1046074281 8:109298869-109298891 CACTTCCTTCAGAGGGTCTGCGG - Intronic
1046204481 8:110974953-110974975 CAGTTCCTTAAGAATGTTAGAGG - Intergenic
1046394499 8:113624903-113624925 CACTTCCTTCAAAGGGTCTGTGG - Intergenic
1047607402 8:126488720-126488742 CAGTTCCTTCAAAGGGTCTGTGG + Intergenic
1047890491 8:129303242-129303264 CAGGTCCTTCAAAGGGTCTTTGG + Intergenic
1048531173 8:135251769-135251791 CAGTTCCTTCAAAGGGTCTGTGG + Intergenic
1048663132 8:136630087-136630109 TGGTTCCTTCTGAAGGCCTGGGG + Intergenic
1049885703 9:24866-24888 CAGTACCTGCAGAAGGTCTCTGG - Intergenic
1049915318 9:311816-311838 CAGTTTCTTCAGAAGACTTGAGG + Intronic
1049940011 9:536443-536465 CAGTTCCTTCTGAAGGTTTTGGG + Intronic
1050400400 9:5247749-5247771 CAGTTCCTTCAAAGCATCTGTGG - Intergenic
1050609243 9:7334235-7334257 AGGCCCCTTCAGAAGGTCTGAGG - Intergenic
1050903402 9:10974431-10974453 CAATTCCTTCAAAGGGTTTGTGG - Intergenic
1050987696 9:12103952-12103974 CACCTCCTTCAAAGGGTCTGTGG - Intergenic
1051182402 9:14425046-14425068 CAATTCCTACAGAAGGCCTTGGG + Intergenic
1051929354 9:22366735-22366757 CCATTCCTTCAAAGGGTCTGTGG - Intergenic
1052092031 9:24340180-24340202 TACTTCCTTCAGAGGGTCTGTGG + Intergenic
1052218289 9:25992356-25992378 CACCTCCTTCAAAGGGTCTGTGG - Intergenic
1052253430 9:26426662-26426684 AAGTTCCTTCAAAGGGTGTGTGG - Intergenic
1052624980 9:30962880-30962902 GACTTTCTTCAGAAGGTCTGTGG + Intergenic
1052731598 9:32291936-32291958 CACTTCTTTCAGAGGGTCTGTGG + Intergenic
1052894457 9:33734522-33734544 CACTTCCCTCAGAGGGTCTGTGG - Intergenic
1053316020 9:37052437-37052459 CAGCTCTTTCAGAGGGGCTGAGG + Intergenic
1053419527 9:37968631-37968653 TAGTTTCTCAAGAAGGTCTGGGG + Intronic
1055156272 9:73066702-73066724 CAGTTCCTTCAGAAGGTCTGTGG - Intronic
1055550545 9:77428532-77428554 CAATTCATTCAGAATCTCTGGGG + Intronic
1055911992 9:81363909-81363931 CAGTTCCTTCAAAGGGTCTGTGG - Intergenic
1056322873 9:85452734-85452756 CACTTCCTTCAGAGGGTCTGTGG + Intergenic
1056396540 9:86186644-86186666 CAGTTCCTTCAAAGGGTCTGTGG - Intergenic
1056699096 9:88887375-88887397 TTCTTCCTTCAGAGGGTCTGTGG + Intergenic
1056726064 9:89118823-89118845 TAATTCCTTCAGAGTGTCTGTGG - Intronic
1056765332 9:89441565-89441587 CACTTCCTTCCCATGGTCTGGGG - Intronic
1056948011 9:91017352-91017374 CACCTCCTTCAAAGGGTCTGTGG - Intergenic
1057119644 9:92559500-92559522 CATTTCCCTCAGAGGGTCTGTGG + Intronic
1057414327 9:94847763-94847785 CAGTGCCTACAGAAGGTCTAAGG - Intronic
1058085171 9:100740449-100740471 CACTTCCTTCAGAGGGCCTGTGG + Intergenic
1058133099 9:101275600-101275622 GAGTTTATTCAGAAGGCCTGAGG - Intronic
1058156805 9:101524849-101524871 CGCTTCCTTCAGAGGGTCTGTGG + Intronic
1058233525 9:102461353-102461375 CAGGTCCTTCAAAGGGGCTGTGG - Intergenic
1058284510 9:103159609-103159631 TAGTTGCTTCATAAGGTCTATGG + Intergenic
1058308544 9:103472074-103472096 CGCTTCCTTCAGAGGGCCTGTGG + Intergenic
1058770721 9:108228570-108228592 CGCTTCCTTCAGAGGATCTGGGG - Intergenic
1058874277 9:109229603-109229625 CAGCTCCTCCAGAAGGTGTGTGG - Intronic
1059609610 9:115878373-115878395 CCCTTCCTTCATAGGGTCTGTGG + Intergenic
1059673732 9:116516613-116516635 TAGTTCCTTCAAAGGGTCTGTGG - Intronic
1060157728 9:121331633-121331655 CAGTTCCTTCAGAAACCCTGAGG + Intronic
1060314566 9:122497190-122497212 CAGTTCCTTCAAAGGGTCTGTGG + Intergenic
1061603143 9:131685995-131686017 CAGTTCCTTCATGCGTTCTGGGG + Intronic
1062705115 9:137934540-137934562 CGCTTCCTTCAGAGGGTCTATGG - Intronic
1185861795 X:3586555-3586577 TAGTTTCTTCAGAAGGCCAGTGG - Intergenic
1185993872 X:4922280-4922302 CGCTTCCTTCAGAGCGTCTGTGG - Intergenic
1186308342 X:8289725-8289747 CAGTTCCTTCAGAGGGTCTGTGG - Intergenic
1186361094 X:8842507-8842529 CAGTTCTTTGATGAGGTCTGAGG - Intergenic
1186962950 X:14757450-14757472 CACTTCCTTCAAAGGGTCTGTGG - Intergenic
1187430794 X:19222257-19222279 CACTTCATTCAAAGGGTCTGTGG + Intergenic
1187588787 X:20693171-20693193 CAGTTCCTTCAAAGGGTCTGTGG - Intergenic
1187738693 X:22331195-22331217 CAGGTCCTTGAGAAGGTGAGAGG + Intergenic
1187748253 X:22432963-22432985 CGTTTCCTTCAGAGGGTCTGTGG - Intergenic
1187752251 X:22479174-22479196 CAGTTCCTTCAAAGCATCTGTGG + Intergenic
1187959824 X:24557933-24557955 CACATCCTTCTGAAGGGCTGGGG + Intergenic
1188046038 X:25426809-25426831 TGCTTCCTTCAGAGGGTCTGTGG + Intergenic
1188389416 X:29601064-29601086 GGGTTCCTTCAAAGGGTCTGTGG + Intronic
1189146543 X:38660993-38661015 CAGTTTCATCATAAGGTCTGTGG + Intronic
1189218033 X:39344337-39344359 TTCTTCCTTCAGAGGGTCTGTGG - Intergenic
1189539440 X:41971080-41971102 CACTTCCTTCAGAGGATCTGTGG - Intergenic
1189567136 X:42254749-42254771 CAGTTCCTTCAGAGGGTCTGTGG - Intergenic
1189879315 X:45472078-45472100 TGCTTCCTTCAGAGGGTCTGTGG + Intergenic
1190448787 X:50557365-50557387 TGCTTCCTTCAGAGGGTCTGTGG - Intergenic
1190632241 X:52399231-52399253 CGCTTCCTTCAGAGGGTCTGTGG + Intergenic
1190985067 X:55492430-55492452 CTGTTGCTTCAGAAGGTTGGAGG - Intergenic
1191026462 X:55919370-55919392 CAGTTCCTTCAAAGGATCTCTGG - Intergenic
1191616541 X:63176154-63176176 CACTTCCTTCAAAGGGTCTGTGG - Intergenic
1191619756 X:63202769-63202791 CACTTCCTTCAAAGGGTCTGTGG + Intergenic
1191692203 X:63952281-63952303 CATTGCCTTCAGAGGATCTGTGG - Intergenic
1191805182 X:65128020-65128042 TAGTTCCTTCAAAGGGTCTGTGG + Intergenic
1191906236 X:66093699-66093721 CTCTTCCTTCAGAGAGTCTGTGG + Intergenic
1191909349 X:66131275-66131297 CAGTTCCTTGAAAGGGTCTGTGG + Intergenic
1191914566 X:66187672-66187694 CATTTCCTTCAGAGGGTCTGTGG + Intronic
1192014832 X:67317811-67317833 CACTTCCTTCAGAGGGTGTATGG + Intergenic
1192069207 X:67918791-67918813 CACTTCCTCCGGATGGTCTGTGG + Intergenic
1192609563 X:72554323-72554345 CAGTTCCTTCAAAGGGTCTGTGG - Intronic
1192674213 X:73177581-73177603 CACCTCCTTCAAAGGGTCTGCGG + Intergenic
1192878116 X:75253679-75253701 TGCTTCCTTCAGAGGGTCTGTGG - Intergenic
1192929490 X:75791399-75791421 CACTTCCTTCAGAGGGACTGTGG - Intergenic
1192950762 X:76014102-76014124 CACTTCCTTCAAAGGGTTTGTGG - Intergenic
1192968296 X:76203056-76203078 CGCTTCCTTCAGAGGGTCTGTGG + Intergenic
1192981931 X:76353527-76353549 CAGTTTCTTCAAAGGGTCTGTGG - Intergenic
1192991869 X:76467853-76467875 CACCTCCTTCAAAAAGTCTGTGG + Intergenic
1192995267 X:76506165-76506187 CACTTCCTTCATAGGGTCTGTGG + Intergenic
1192995339 X:76506625-76506647 CAATTTCTTCAAAGGGTCTGTGG + Intergenic
1193016637 X:76741224-76741246 CAGTTTTTTCAAAGGGTCTGTGG - Intergenic
1193057553 X:77169241-77169263 CAGCTCCTTCAAAAGGTCTGTGG + Intergenic
1193076881 X:77364300-77364322 CATTTCCTTCAGAGGTTCTGTGG - Intergenic
1193154457 X:78158181-78158203 TTCTTCCTTCAGAGGGTCTGTGG - Intergenic
1193156715 X:78182609-78182631 GGCTTCCTTCAGAGGGTCTGTGG - Intergenic
1193196886 X:78643239-78643261 CACCTCCTTCAAAGGGTCTGTGG - Intergenic
1193366308 X:80637943-80637965 CAGTTCCTTCAAAGGGTCTGTGG - Intergenic
1193420672 X:81279444-81279466 CACTTCCTTGAGAGGGTCTGTGG - Intronic
1193447591 X:81622598-81622620 CACCTCCTTCAAAGGGTCTGTGG + Intergenic
1193631772 X:83898759-83898781 CACTTCCATCAAAGGGTCTGTGG - Intergenic
1193681104 X:84519354-84519376 AGCTTCCTTCAGAGGGTCTGTGG + Intergenic
1193779777 X:85686938-85686960 TGCTTCCTTCAGAGGGTCTGTGG + Intergenic
1193786129 X:85761195-85761217 TACTTCTTTCAGAGGGTCTGTGG + Intergenic
1193791523 X:85821136-85821158 CACTTTCTTCAGAGAGTCTGTGG - Intergenic
1193817595 X:86122477-86122499 CAGTTCCTTCAAAGGGTCTGTGG + Intergenic
1193937061 X:87636477-87636499 CACCTCCCTCAGAGGGTCTGTGG - Intronic
1194095442 X:89632982-89633004 CACTTCTTTCAAAGGGTCTGTGG + Intergenic
1194165243 X:90507435-90507457 CACTTCCTTCAAAGGGTCTGTGG - Intergenic
1194228969 X:91298630-91298652 CAGTTTCTTCAGAATGTCGATGG + Intergenic
1194299224 X:92163716-92163738 CACTTCCTTCAGAGGGTCTGTGG + Intronic
1194380866 X:93190528-93190550 CAGTTCCTTCAAAGGGTCTGTGG - Intergenic
1194466315 X:94238299-94238321 CACTTCCTTCAGAGGGTCTGTGG + Intergenic
1194470301 X:94285621-94285643 CAGTTCATTCAAAGGGTCTGTGG + Intergenic
1194601169 X:95923571-95923593 CAGTTCCTTCAAAAGGTCTTTGG - Intergenic
1194602502 X:95940185-95940207 CAGTTCCTTCAAAGGGTCTGTGG - Intergenic
1194605564 X:95974534-95974556 CACTTCCTTCAGAGGGTCTGTGG - Intergenic
1194701628 X:97120410-97120432 CCCTTCCTTCAGAGGGTCTGTGG + Intronic
1194901622 X:99519598-99519620 CACTTCTTTCAAAGGGTCTGTGG - Intergenic
1194927048 X:99837236-99837258 CACTTCCTTCAGAGGGTCTGTGG + Intergenic
1194932297 X:99902087-99902109 CACTTCCTTCAGAGGGTCTGTGG + Intergenic
1195075689 X:101325663-101325685 TGCTTCCTTCAGAGGGTCTGTGG - Intergenic
1195237030 X:102910976-102910998 CAGTTTCTTCAAAGGGTCTGTGG - Intergenic
1195734109 X:107995803-107995825 CACTTCTTTCAAAGGGTCTGTGG - Intergenic
1196023954 X:111020649-111020671 CAGTTCCTTCAAAGGGTCTGTGG - Intronic
1196231951 X:113233972-113233994 CAGTTCCTTCAAAGGGTCTGTGG + Intergenic
1196235396 X:113274185-113274207 CGCTTCCTTCAGAGGGTCTGTGG - Intergenic
1196519430 X:116655318-116655340 CACCTCCTTCAAAGGGTCTGTGG + Intergenic
1196523390 X:116701143-116701165 CAGTTATTTCAGAAGCTCAGTGG - Intergenic
1196675884 X:118419558-118419580 TGCTTCCTTCAGAGGGTCTGTGG + Intronic
1196737427 X:118992190-118992212 CGCTTCCTTCAGAGGGACTGTGG - Intronic
1196748230 X:119090820-119090842 CACTTCTTTCAAAGGGTCTGTGG - Intronic
1196948949 X:120856981-120857003 CAGTTCCTTCAAATGGTCTGTGG - Intergenic
1197034713 X:121859674-121859696 CAGGTCCTTCAAAGTGTCTGTGG + Intergenic
1197066361 X:122237960-122237982 CGCTTCCTTCAGAGGGTCTGTGG + Intergenic
1197081817 X:122426785-122426807 CAGTTCCTTCAAAGGGTCTGTGG + Intergenic
1197102520 X:122673225-122673247 CGTTTCCTTCAGAGGGTCTGTGG - Intergenic
1197132262 X:123019428-123019450 TGCTTCCTTCAGAGGGTCTGTGG - Intergenic
1197150687 X:123217184-123217206 CAGGGCCTTCAGAAGGTCACTGG + Intronic
1197515575 X:127423302-127423324 CAGTTCCTTCAAAGGGTCTGAGG + Intergenic
1197588785 X:128383526-128383548 CACTTCCTTCAGAGGGTCTGTGG - Intergenic
1197669091 X:129255949-129255971 CCCTTCCTTCAGCGGGTCTGTGG + Intergenic
1197953562 X:131923177-131923199 CGCTTCCTTCAGAGCGTCTGTGG - Intergenic
1198604607 X:138322797-138322819 CAGATCCTTCAAAGAGTCTGTGG + Intergenic
1198664682 X:139007798-139007820 CAGTTCCTTCAAAGGGTCTGTGG - Intronic
1198797336 X:140410931-140410953 CACCTCCTTCAAAGGGTCTGTGG + Intergenic
1198843099 X:140880306-140880328 CACTTCCTTCATAGAGTCTGTGG - Intergenic
1198929435 X:141837680-141837702 CACTTCATTCAAAGGGTCTGTGG + Intergenic
1199015014 X:142804758-142804780 CAGTTTCTTCAAAGGGTCTGTGG + Intergenic
1199121537 X:144060621-144060643 CAGTTCCTTCAAAAGGTCTGTGG - Intergenic
1199298730 X:146187765-146187787 CACTTCTTTCAAAGGGTCTGTGG + Intergenic
1199521639 X:148742025-148742047 TCCTTCCTTCAGAGGGTCTGTGG + Intronic
1199668375 X:150120546-150120568 TGCTTCCTTCAGAGGGTCTGTGG - Intergenic
1199913600 X:152315112-152315134 TGCTTCCTTCAAAAGGTCTGTGG - Intronic
1200164388 X:154026175-154026197 CAGTTCTTTAAGAAGATCTTTGG - Intronic
1200332624 X:155313684-155313706 CAGTTCCTTCAAAGGGTCTGTGG - Intronic
1200414937 Y:2899792-2899814 TTCTTCCTTCAGAGGGTCTGTGG - Intronic
1200448076 Y:3289160-3289182 CACTTCTTTCAAAGGGTCTGTGG + Intergenic
1200511507 Y:4085245-4085267 CACTTCCTTCAAAGGGTCTGTGG - Intergenic
1200616828 Y:5388550-5388572 CACTTCCTTCAGAGGGTCTGTGG + Intronic
1201315684 Y:12643479-12643501 TGCTTCCTTCAGAGGGTCTGTGG - Intergenic
1201408344 Y:13672457-13672479 AACTTCCTTCAGAGGGTCTGTGG - Intergenic
1201682215 Y:16659367-16659389 TACTTCCTTCAGATGGTCTGTGG - Intergenic
1201682289 Y:16660407-16660429 TGCTTCCTTCAGAGGGTCTGTGG + Intergenic
1202043605 Y:20713930-20713952 CACTTCCTTCAGAGAATCTGTGG - Intergenic