ID: 1055157298

View in Genome Browser
Species Human (GRCh38)
Location 9:73080093-73080115
Sequence AATTCAGATTGAATTATCAC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 208
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 192}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055157298_1055157304 30 Left 1055157298 9:73080093-73080115 CCCGTGATAATTCAATCTGAATT 0: 1
1: 0
2: 0
3: 15
4: 192
Right 1055157304 9:73080146-73080168 TTATGAAAACCAAAGCATTTGGG No data
1055157298_1055157303 29 Left 1055157298 9:73080093-73080115 CCCGTGATAATTCAATCTGAATT 0: 1
1: 0
2: 0
3: 15
4: 192
Right 1055157303 9:73080145-73080167 CTTATGAAAACCAAAGCATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055157298 Original CRISPR AATTCAGATTGAATTATCAC GGG (reversed) Intronic
905341506 1:37281552-37281574 AATTCAGCTGGAAGTGTCACAGG - Intergenic
906258210 1:44366845-44366867 AAGTCAGAGTGAGTTAGCACTGG + Intergenic
908990017 1:70075790-70075812 AATTCAGTTTGAAAAATCTCAGG - Intronic
909939948 1:81599578-81599600 AATTCTAATTCCATTATCACTGG - Intronic
909975003 1:82035652-82035674 AACTGAGATTGAATTATAGCAGG + Intergenic
911322136 1:96427677-96427699 ATTTCAAGTTGAATTATCAGGGG - Intergenic
911633263 1:100206258-100206280 ACTTCAGGTGGCATTATCACTGG + Exonic
913660704 1:121004235-121004257 TATTCAGATTTCATGATCACAGG - Intergenic
914012068 1:143787391-143787413 TATTCAGATTTCATGATCACAGG - Intergenic
914165764 1:145173743-145173765 TATTCAGATTTCATGATCACAGG + Intergenic
914650698 1:149696054-149696076 TATTCAGATTTCATGATCACAGG - Intergenic
916724004 1:167506738-167506760 AATTCTGATTAATTTATCATAGG + Intronic
918295406 1:183151614-183151636 AATACACATTGAATTATGATGGG - Intergenic
918390585 1:184055909-184055931 AATTCAGAATGAGTTACCTCAGG - Intronic
918985509 1:191620262-191620284 AATTCAGAATCAATGAACACGGG + Intergenic
919294569 1:195679650-195679672 ACTTGAGATTGAGATATCACAGG + Intergenic
919831452 1:201543480-201543502 AATTCAGAGGGATTTATCCCAGG - Intergenic
922132025 1:222789264-222789286 TATTCAGATTGCATTATGACTGG - Intergenic
1065677095 10:28188095-28188117 AATTTAGGTTGAATTCTCAAAGG - Intronic
1068595309 10:58896558-58896580 AATTCTGATTGAAGTAACTCTGG - Intergenic
1070482391 10:76895688-76895710 AATGTACATTGAATTATCAGAGG - Intronic
1073522119 10:104142207-104142229 AAATCAGGTTGTGTTATCACTGG - Intronic
1073922489 10:108475248-108475270 AAGTCAGAGTGTATTATAACTGG + Intergenic
1075284331 10:121170276-121170298 AATTTACATTGCATTATCAAGGG - Intergenic
1079435861 11:20448938-20448960 AATTCAGACTGTAATTTCACAGG - Intronic
1080081912 11:28230811-28230833 AATTTAGATTGCATTCTCTCAGG - Intronic
1080220255 11:29894734-29894756 AATAGATAATGAATTATCACAGG + Intergenic
1080303473 11:30811379-30811401 TTTTCAGATAGAATTATCACAGG - Intergenic
1080984758 11:37448929-37448951 TATTCAGTCTGAATTATCTCAGG + Intergenic
1085810511 11:79676595-79676617 AATTCATATTGAATTACACCTGG + Intergenic
1086286319 11:85255589-85255611 AATTTAGATTGCCTTATCAGGGG - Intronic
1087555489 11:99714343-99714365 AATTAAGCTTTAATTTTCACTGG + Intronic
1087629113 11:100629789-100629811 AGTTTGGATTGAATTTTCACTGG + Intergenic
1088338448 11:108735469-108735491 ATTTCAGATAGAATGATCAGAGG + Intronic
1090602811 11:128390287-128390309 AATTTATATTGCATAATCACAGG + Intergenic
1092708036 12:11306003-11306025 AATTCATAGTGAATTATCTGAGG + Intergenic
1092733009 12:11551952-11551974 AATTTAGATAGAATCATCATTGG + Intergenic
1093122048 12:15282708-15282730 AATGCAGCTTGAAACATCACTGG - Intronic
1093143815 12:15540794-15540816 AATTTAGATTGGATTATGAGAGG - Intronic
1094001283 12:25697625-25697647 AAATGAAATTGCATTATCACTGG + Intergenic
1094022899 12:25933197-25933219 AATTAAAATGGGATTATCACAGG + Intergenic
1094344601 12:29453347-29453369 AATTCAGAAAGAATTATGACAGG - Intronic
1094385007 12:29884781-29884803 AAATAACATTGAATTATCAGGGG - Intergenic
1095125228 12:38469399-38469421 AATTTCGATTGAACTGTCACTGG + Intergenic
1095309755 12:40684583-40684605 AATTCAGATATTATAATCACAGG - Intergenic
1097708520 12:62893781-62893803 AATTCAGATTAAATGAACGCGGG - Intronic
1099020864 12:77402574-77402596 AATTCAAATTGATTTATTATAGG + Intergenic
1100005217 12:89887340-89887362 AAATCAGAATGAATCATCACTGG - Intergenic
1100344355 12:93712626-93712648 AATTAACAATGAATTATCCCTGG - Intronic
1101209062 12:102518149-102518171 AATTCAGAAAGAATATTCACAGG + Intergenic
1102209661 12:111116682-111116704 AATTCAGAGTAAACTATCTCTGG - Intronic
1106204774 13:27582617-27582639 AATTCAGAATCAACTAACACAGG + Intronic
1107154380 13:37149456-37149478 AATTAAGAATGAATCTTCACAGG + Intergenic
1107520440 13:41175332-41175354 AACTTACATTGAATTATCAGGGG - Intergenic
1110029370 13:70586854-70586876 ATATCACATTGAACTATCACTGG + Intergenic
1113304086 13:109057836-109057858 ATTTCATATTGAATCATCTCTGG - Intronic
1116414073 14:44659586-44659608 AATTCACACTGACTTATCAGGGG + Intergenic
1117947675 14:61046620-61046642 CCTTCAGATCTAATTATCACAGG + Intronic
1120665706 14:87304217-87304239 ATTTAAGATTCAATTATCTCAGG + Intergenic
1123398196 15:19957638-19957660 GATTCACATGGAATTATCCCTGG - Intergenic
1124111112 15:26788937-26788959 AATACACACTGAATTATCAGAGG + Intronic
1124617691 15:31254229-31254251 CATTGAAATTGAATTATCTCAGG + Intergenic
1125129512 15:36266303-36266325 CATTCAGAATGATTTATTACAGG - Intergenic
1125241720 15:37583318-37583340 AATTCAGTTCAAATTGTCACAGG - Intergenic
1127874097 15:63097786-63097808 AATTCTATTTGAATTGTCACAGG + Intergenic
1128392996 15:67195740-67195762 AATTCAAAATGAATTTTCACAGG - Intergenic
1128752810 15:70161223-70161245 GATTCAGATTGCATTAGCAGGGG - Intergenic
1128794729 15:70457782-70457804 AAGTCAGATTGCAGTATCAAAGG - Intergenic
1130314066 15:82780112-82780134 AATCCTGATTAAATTAGCACTGG - Intronic
1133628967 16:7600754-7600776 AATTCAGTCTTATTTATCACTGG - Intronic
1134767936 16:16778111-16778133 AATTCAGTATGAATTCTGACGGG - Intergenic
1134888118 16:17812720-17812742 AATTGATACTGCATTATCACTGG + Intergenic
1135160634 16:20092472-20092494 AATTCAGTTTGAAATATTCCTGG + Intergenic
1136053438 16:27670081-27670103 AATTCAAATTTCTTTATCACAGG + Intronic
1140284980 16:73594478-73594500 AATTAAGATAGAATTAAGACTGG + Intergenic
1149170212 17:53800773-53800795 TAAGCAGATTGACTTATCACTGG - Intergenic
1149230572 17:54529535-54529557 AATACATATTAAATTATGACAGG + Intergenic
1151050620 17:70974313-70974335 AATTAAGATTTAATTGTGACAGG + Intergenic
1151098155 17:71523002-71523024 AATTCTAAGTGAATTAACACAGG + Intergenic
1156145907 18:34177563-34177585 AATACACATTTAATTAGCACAGG + Intronic
1160207457 18:76846600-76846622 AATTCAAATTAAAGTATGACTGG - Intronic
1160611649 18:80092780-80092802 AATTCATATAGAATTATAAGGGG + Intronic
1164227828 19:23261448-23261470 AATAGAGAGTGACTTATCACTGG - Intergenic
1166639542 19:44483832-44483854 AATTCAGTTTAAATGATTACAGG - Intronic
1167290673 19:48623703-48623725 AATTCAGACTTATTTATCTCAGG - Intronic
1167858356 19:52261440-52261462 AAATCTTATTTAATTATCACTGG - Intergenic
925230885 2:2232974-2232996 AATTTAGCTTGAAAAATCACTGG + Intronic
925860239 2:8168259-8168281 GATTCAGATTGAATTGTGCCTGG - Intergenic
926741900 2:16118442-16118464 AATTCAGCTTTAACTTTCACAGG - Intergenic
926811079 2:16756004-16756026 AAATCAGTTTGTATTTTCACTGG - Intergenic
926816371 2:16801908-16801930 AAATAACATTGAATTATCAGGGG + Intergenic
931116022 2:59167709-59167731 TATTTACCTTGAATTATCACAGG + Intergenic
931513283 2:63023619-63023641 AATTCAGAGTGAACTGGCACTGG - Intronic
932039387 2:68283130-68283152 AATTCAGAGTAAATTGTCAAGGG + Intergenic
932136879 2:69239231-69239253 AATTCAGATTAAATTATCCAAGG + Intronic
933441201 2:82316541-82316563 AATTCTGATTTAATTGTTACAGG + Intergenic
933509510 2:83222248-83222270 GTTTAAGATTAAATTATCACAGG - Intergenic
937618854 2:123961739-123961761 AATTCTTATTGAAATATCAATGG + Intergenic
937743505 2:125383874-125383896 AATTCAAAATGAATTATCTTGGG + Intergenic
938312955 2:130306132-130306154 AATGGAAATAGAATTATCACTGG - Intergenic
941443705 2:165572939-165572961 AATACAGATTGTTTTAACACTGG - Intronic
941509951 2:166395092-166395114 AATTAAGAGTCAATTATCATGGG + Intergenic
941512554 2:166431332-166431354 AATTCAGTTTCAATTATCCAAGG - Intronic
944892525 2:204132444-204132466 AATTCAGATGTAACCATCACAGG + Intergenic
945291163 2:208128781-208128803 AATGTAGTTTGAATTAACACAGG - Intronic
1177145905 21:17406743-17406765 AATCCAGATTGAAGAATTACAGG + Intergenic
951731343 3:25813545-25813567 AATCCTGAGTGAATTAACACAGG - Intergenic
955100242 3:55841950-55841972 AATACACATTTAATTAGCACAGG - Intronic
955640836 3:61082134-61082156 AAATCAGAATGAATTTTTACAGG + Intronic
955660678 3:61295502-61295524 AATTCAGATTTGGTTATTACAGG + Intergenic
955946384 3:64198571-64198593 AATACAGAATGAATTAGCAATGG + Intronic
958500987 3:94908314-94908336 AATTCAAAATGATTTAGCACTGG + Intergenic
958882190 3:99684963-99684985 AGTTCAGTTTTAAGTATCACTGG - Intronic
960167239 3:114416935-114416957 AATTCAGAATGAATCACCAAAGG - Intronic
964221060 3:154345629-154345651 AACTCTGAATCAATTATCACAGG - Intronic
964368890 3:155978311-155978333 ACTTCAGCTTGAATTTTCTCAGG + Intergenic
964963960 3:162465970-162465992 AATTAACATTGAATTTTCAATGG - Intergenic
965122955 3:164587089-164587111 AATTCAGATTCAGTCAACACTGG + Intergenic
965576959 3:170227258-170227280 AACTCAGTTTGAATGATCTCTGG - Intronic
966638269 3:182159699-182159721 ATTTGAATTTGAATTATCACTGG - Intergenic
967153452 3:186670868-186670890 TTTTCAAATAGAATTATCACAGG + Intronic
967871351 3:194232300-194232322 AATTCAGCTTGAGTTTCCACAGG - Intergenic
972031864 4:34470764-34470786 AAATGAGCTAGAATTATCACAGG + Intergenic
973711972 4:53639207-53639229 TCTTCTCATTGAATTATCACAGG + Intronic
974136959 4:57830362-57830384 AAGTCATAGTGAATTATCAGAGG + Intergenic
974989650 4:69070074-69070096 CATTAAAATTGAATTATTACAGG - Intronic
975402419 4:73953160-73953182 GACTCACATTGAATTATCAGGGG - Intergenic
976492466 4:85687529-85687551 AATCCTGAGTGAATTAACACAGG - Intronic
976960961 4:90972670-90972692 AATTCATATGGAATCATAACAGG + Intronic
978291280 4:107144046-107144068 AATTTAGATGGAATTTTTACAGG - Intronic
978976834 4:114887349-114887371 AATTCAGATTCAAAAGTCACAGG - Intronic
979123075 4:116927295-116927317 ATTTCAGAATGTATTATAACAGG - Intergenic
979268793 4:118735031-118735053 ATATCAGATTGAAATTTCACTGG + Intronic
980981616 4:139659031-139659053 ACTTCAGATTTAATTAGCTCAGG - Intergenic
982462065 4:155682803-155682825 AATTTTGATTGAATTATAAATGG + Intronic
982731585 4:158961534-158961556 AATTCAAATTCAATTTTCAGGGG - Intronic
983316796 4:166142888-166142910 ACTTCTGATTGTATTCTCACAGG + Intergenic
984256094 4:177391773-177391795 GGTTCAGTTTGAATTATCTCTGG + Intergenic
984467745 4:180122989-180123011 AATACTGATTTATTTATCACTGG + Intergenic
984520099 4:180791546-180791568 ATATCAGATTGAATTAAAACAGG + Intergenic
985323846 4:188744792-188744814 ACTTCAGATTGAGTGATTACTGG - Intergenic
986063926 5:4217466-4217488 AATTTTGATTTCATTATCACTGG - Intergenic
987729814 5:21754461-21754483 AATTCATAATAAATTATCCCTGG - Intronic
988373939 5:30408653-30408675 AATTCAGAGTGAATTACCCCAGG - Intergenic
988447901 5:31309243-31309265 AATAGATATTCAATTATCACAGG - Intronic
990866273 5:60384109-60384131 ATTTCTGTTTGAATTATCACAGG - Intronic
992472540 5:77072637-77072659 AAGTCAGATTGAGTTTTGACTGG + Exonic
993207442 5:84900694-84900716 AATCCAGAGTGAATTAAGACAGG - Intergenic
993793388 5:92235434-92235456 AAATCAAATTGAATAATTACTGG - Intergenic
994060646 5:95472872-95472894 AATTCTAAGTGAATTAACACAGG - Intronic
994122139 5:96127165-96127187 AATTCAGGTAAAATTATCAGAGG - Intergenic
994977051 5:106821672-106821694 ATTTCAAAATGAATTATAACAGG - Intergenic
996395364 5:123008193-123008215 ATTTCAGAATGTACTATCACTGG - Exonic
998077285 5:139246954-139246976 AATACAGATACCATTATCACCGG + Intronic
1002760148 6:195484-195506 AATCCAGCTTGAATTATCTTTGG - Intergenic
1003656263 6:8012663-8012685 AATTCAAATTCAATTAAAACAGG + Intronic
1004837561 6:19545070-19545092 ATTTCAGATTAAATCCTCACGGG + Intergenic
1005998033 6:30943433-30943455 AGTCTAGATTAAATTATCACAGG + Intronic
1005998037 6:30943469-30943491 AGTCCAGATTAAATCATCACAGG + Intronic
1008292045 6:49727841-49727863 AAATCTGAATGACTTATCACTGG + Exonic
1010047375 6:71461728-71461750 AATTCAGAGTTACTTTTCACAGG + Intergenic
1010911384 6:81561470-81561492 ATTTCAGACAGAATTTTCACAGG - Intronic
1012834962 6:104253133-104253155 AATTAAGGCTGAATTATCACAGG - Intergenic
1013743859 6:113321209-113321231 AGTCCAGATTGAATCATCTCTGG + Intergenic
1014247084 6:119080358-119080380 AGTTCAGAGTGAATTACCAGTGG - Intronic
1015442239 6:133262493-133262515 AATTCTGAGTGAATTGTCCCAGG - Intronic
1016275010 6:142339197-142339219 AATTCATAATCACTTATCACGGG + Intronic
1017344374 6:153362966-153362988 AATGAAGAGTGAATTATTACAGG + Intergenic
1022205391 7:28158795-28158817 ATATCAGATTGAATTCTCAATGG - Intronic
1022816511 7:33919384-33919406 AATTCAGAGTGAATTTGCACTGG + Intronic
1022851003 7:34262096-34262118 AATTCAGAATGATTTTTCATAGG - Intergenic
1023365114 7:39456289-39456311 AAGCCAGATTGAACTATCCCAGG + Intronic
1024059652 7:45688211-45688233 AAGACAGATTGACCTATCACTGG - Intronic
1028859034 7:95626978-95627000 AATTCAGAGTGATTTTTCTCAGG - Intergenic
1031390747 7:121211584-121211606 AGATCAGCTTGAACTATCACAGG + Intronic
1031581153 7:123476666-123476688 AATCCAGATTCAATTATGTCAGG + Intronic
1036607396 8:10319639-10319661 AACTCAGGTAGATTTATCACAGG - Intronic
1040756697 8:50783848-50783870 ACTTCAGTTTGAGTTTTCACTGG + Intronic
1042492268 8:69413120-69413142 AATACAGAGTGAATTATTAAAGG + Intergenic
1042942377 8:74120413-74120435 ATTTCTGATTGATTTTTCACAGG + Intergenic
1043060121 8:75489515-75489537 AATTCAGATACAAGTATAACAGG - Intronic
1043938103 8:86166218-86166240 AAATCAGACTGAATTGTCAAGGG + Intergenic
1044571806 8:93727456-93727478 ACTTCAGAATGCATTATCCCAGG + Intronic
1046125036 8:109895526-109895548 AATTCAGATTTAATTAATTCAGG + Intergenic
1046609195 8:116405259-116405281 AGCTGAGATAGAATTATCACTGG - Intergenic
1048629151 8:136221889-136221911 AATTCTAAGTGAATTAACACAGG + Intergenic
1050283585 9:4078105-4078127 AATTGAGAATGAATTATCTCTGG + Intronic
1050791849 9:9481941-9481963 AAATCTGCTTGAATTATCACAGG + Intronic
1050865767 9:10497023-10497045 AATCCTAAGTGAATTATCACAGG + Intronic
1052400536 9:27994578-27994600 AATGCAGAGTGAATGATTACAGG - Intronic
1052625227 9:30966750-30966772 AATTCAGTTTTAATTTTCAAAGG - Intergenic
1055157298 9:73080093-73080115 AATTCAGATTGAATTATCACGGG - Intronic
1055966380 9:81869057-81869079 AATTCAGATTCTAGTATCAAAGG - Intergenic
1058891033 9:109360891-109360913 AAGTCAAAATGAATAATCACTGG - Intergenic
1062689389 9:137833632-137833654 AATTCAGAATCCATCATCACAGG + Intronic
1185814221 X:3139285-3139307 AATTCATGTTTTATTATCACTGG + Intergenic
1185953862 X:4467284-4467306 AATTCACATTTAATCATCACAGG - Intergenic
1186151441 X:6678807-6678829 AATTGAGAATGAATTGTCTCTGG + Intergenic
1186343971 X:8672236-8672258 AGGTCAGATTGAGTTAACACTGG + Intronic
1188676928 X:32952831-32952853 AATTCAAATTGAAATTTCACTGG + Intronic
1190894173 X:54600096-54600118 CATTCAGTTTGAATTATTTCTGG + Intergenic
1192485659 X:71523509-71523531 ATTTCAAATTGTATTATGACAGG + Intronic
1192916749 X:75659618-75659640 AATCCTGACTGAATTAACACAGG - Intergenic
1196349919 X:114716569-114716591 CATTCAAATTGAATAATCACTGG + Intronic
1199360722 X:146915428-146915450 AACCCACATTGAATTATCAGGGG - Intergenic
1201267489 Y:12222227-12222249 AATTCATATTTTGTTATCACTGG - Intergenic
1202340417 Y:23858705-23858727 AAATTACATTGAATTATCAGTGG + Intergenic
1202530349 Y:25811377-25811399 AAATTACATTGAATTATCAGTGG - Intergenic