ID: 1055160206

View in Genome Browser
Species Human (GRCh38)
Location 9:73117462-73117484
Sequence CAAAATAACTACATGGAGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055160201_1055160206 5 Left 1055160201 9:73117434-73117456 CCCATTGGTCAGGGTAGTCTTGT No data
Right 1055160206 9:73117462-73117484 CAAAATAACTACATGGAGACTGG No data
1055160202_1055160206 4 Left 1055160202 9:73117435-73117457 CCATTGGTCAGGGTAGTCTTGTT No data
Right 1055160206 9:73117462-73117484 CAAAATAACTACATGGAGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055160206 Original CRISPR CAAAATAACTACATGGAGAC TGG Intergenic
No off target data available for this crispr