ID: 1055164614

View in Genome Browser
Species Human (GRCh38)
Location 9:73176118-73176140
Sequence AAAGAGAGACTTTACTGAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055164614_1055164620 26 Left 1055164614 9:73176118-73176140 CCCTCTCAGTAAAGTCTCTCTTT No data
Right 1055164620 9:73176167-73176189 ATGTTAACCACTATTCTCTGTGG No data
1055164614_1055164618 2 Left 1055164614 9:73176118-73176140 CCCTCTCAGTAAAGTCTCTCTTT No data
Right 1055164618 9:73176143-73176165 TAAAAATGGATTTGGCACTATGG No data
1055164614_1055164619 3 Left 1055164614 9:73176118-73176140 CCCTCTCAGTAAAGTCTCTCTTT No data
Right 1055164619 9:73176144-73176166 AAAAATGGATTTGGCACTATGGG No data
1055164614_1055164617 -6 Left 1055164614 9:73176118-73176140 CCCTCTCAGTAAAGTCTCTCTTT No data
Right 1055164617 9:73176135-73176157 CTCTTTGTTAAAAATGGATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055164614 Original CRISPR AAAGAGAGACTTTACTGAGA GGG (reversed) Intergenic
No off target data available for this crispr