ID: 1055164619

View in Genome Browser
Species Human (GRCh38)
Location 9:73176144-73176166
Sequence AAAAATGGATTTGGCACTAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055164611_1055164619 27 Left 1055164611 9:73176094-73176116 CCTAAAATGTAGGGGGTTAGAGG No data
Right 1055164619 9:73176144-73176166 AAAAATGGATTTGGCACTATGGG No data
1055164613_1055164619 4 Left 1055164613 9:73176117-73176139 CCCCTCTCAGTAAAGTCTCTCTT No data
Right 1055164619 9:73176144-73176166 AAAAATGGATTTGGCACTATGGG No data
1055164615_1055164619 2 Left 1055164615 9:73176119-73176141 CCTCTCAGTAAAGTCTCTCTTTG No data
Right 1055164619 9:73176144-73176166 AAAAATGGATTTGGCACTATGGG No data
1055164614_1055164619 3 Left 1055164614 9:73176118-73176140 CCCTCTCAGTAAAGTCTCTCTTT No data
Right 1055164619 9:73176144-73176166 AAAAATGGATTTGGCACTATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055164619 Original CRISPR AAAAATGGATTTGGCACTAT GGG Intergenic
No off target data available for this crispr