ID: 1055166751

View in Genome Browser
Species Human (GRCh38)
Location 9:73205332-73205354
Sequence ATGTATCAGCCTATGACATG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055166751_1055166753 17 Left 1055166751 9:73205332-73205354 CCACATGTCATAGGCTGATACAT No data
Right 1055166753 9:73205372-73205394 CAGAAAGCTTTGTTAAATATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055166751 Original CRISPR ATGTATCAGCCTATGACATG TGG (reversed) Intergenic
No off target data available for this crispr