ID: 1055167538

View in Genome Browser
Species Human (GRCh38)
Location 9:73215493-73215515
Sequence CAGGCTCCACGTGGGGAGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055167533_1055167538 26 Left 1055167533 9:73215444-73215466 CCTCACTTTCACTTCAGGTGGTT No data
Right 1055167538 9:73215493-73215515 CAGGCTCCACGTGGGGAGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055167538 Original CRISPR CAGGCTCCACGTGGGGAGAG AGG Intergenic
No off target data available for this crispr