ID: 1055171248

View in Genome Browser
Species Human (GRCh38)
Location 9:73260768-73260790
Sequence CTGTTGTCTTTGTTCATCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055171244_1055171248 27 Left 1055171244 9:73260718-73260740 CCACTTATCAGCTGTATGTATGA No data
Right 1055171248 9:73260768-73260790 CTGTTGTCTTTGTTCATCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055171248 Original CRISPR CTGTTGTCTTTGTTCATCTC TGG Intergenic
No off target data available for this crispr