ID: 1055172112

View in Genome Browser
Species Human (GRCh38)
Location 9:73271398-73271420
Sequence ATGCTTTTGTTGTTGAAACA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055172110_1055172112 10 Left 1055172110 9:73271365-73271387 CCCTGACAAATGCATGTTGTTTT No data
Right 1055172112 9:73271398-73271420 ATGCTTTTGTTGTTGAAACAAGG No data
1055172111_1055172112 9 Left 1055172111 9:73271366-73271388 CCTGACAAATGCATGTTGTTTTT No data
Right 1055172112 9:73271398-73271420 ATGCTTTTGTTGTTGAAACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055172112 Original CRISPR ATGCTTTTGTTGTTGAAACA AGG Intergenic
No off target data available for this crispr