ID: 1055172530

View in Genome Browser
Species Human (GRCh38)
Location 9:73276441-73276463
Sequence AGGTGGGGATAGAGTTAAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055172520_1055172530 20 Left 1055172520 9:73276398-73276420 CCTGCTTGGGTTAAACTGATGAA No data
Right 1055172530 9:73276441-73276463 AGGTGGGGATAGAGTTAAGCTGG No data
1055172528_1055172530 -8 Left 1055172528 9:73276426-73276448 CCAGTAGGGGATCATAGGTGGGG No data
Right 1055172530 9:73276441-73276463 AGGTGGGGATAGAGTTAAGCTGG No data
1055172518_1055172530 30 Left 1055172518 9:73276388-73276410 CCCAGGGGTGCCTGCTTGGGTTA No data
Right 1055172530 9:73276441-73276463 AGGTGGGGATAGAGTTAAGCTGG No data
1055172519_1055172530 29 Left 1055172519 9:73276389-73276411 CCAGGGGTGCCTGCTTGGGTTAA No data
Right 1055172530 9:73276441-73276463 AGGTGGGGATAGAGTTAAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055172530 Original CRISPR AGGTGGGGATAGAGTTAAGC TGG Intergenic
No off target data available for this crispr