ID: 1055174510

View in Genome Browser
Species Human (GRCh38)
Location 9:73300395-73300417
Sequence CAAAATGCTGATAATGATAC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055174510_1055174514 4 Left 1055174510 9:73300395-73300417 CCCGTATCATTATCAGCATTTTG No data
Right 1055174514 9:73300422-73300444 AAGCCATTCAGCAAATCTCTAGG No data
1055174510_1055174515 5 Left 1055174510 9:73300395-73300417 CCCGTATCATTATCAGCATTTTG No data
Right 1055174515 9:73300423-73300445 AGCCATTCAGCAAATCTCTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055174510 Original CRISPR CAAAATGCTGATAATGATAC GGG (reversed) Intergenic
No off target data available for this crispr