ID: 1055181573

View in Genome Browser
Species Human (GRCh38)
Location 9:73394035-73394057
Sequence TTGGCTAAAGAAACCCATAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055181570_1055181573 5 Left 1055181570 9:73394007-73394029 CCAGGAATCTTCATGAATATTTC No data
Right 1055181573 9:73394035-73394057 TTGGCTAAAGAAACCCATAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055181573 Original CRISPR TTGGCTAAAGAAACCCATAA AGG Intergenic
No off target data available for this crispr