ID: 1055187945

View in Genome Browser
Species Human (GRCh38)
Location 9:73478647-73478669
Sequence GAGTTATGAGAGATGGAACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055187945_1055187950 17 Left 1055187945 9:73478647-73478669 CCCTGTTCCATCTCTCATAACTC No data
Right 1055187950 9:73478687-73478709 CTTCTGAGTTCCTATAGATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055187945 Original CRISPR GAGTTATGAGAGATGGAACA GGG (reversed) Intergenic
No off target data available for this crispr