ID: 1055193521

View in Genome Browser
Species Human (GRCh38)
Location 9:73557747-73557769
Sequence TGGCACAGTCATAGTAGGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055193521_1055193527 -2 Left 1055193521 9:73557747-73557769 CCCTGCCTACTATGACTGTGCCA No data
Right 1055193527 9:73557768-73557790 CAGTTAGGGTCCCAGACATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055193521 Original CRISPR TGGCACAGTCATAGTAGGCA GGG (reversed) Intergenic
No off target data available for this crispr