ID: 1055198783

View in Genome Browser
Species Human (GRCh38)
Location 9:73630245-73630267
Sequence GCTTGGTCTGGACCTGCTAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055198778_1055198783 -10 Left 1055198778 9:73630232-73630254 CCCCACCAGACTTGCTTGGTCTG No data
Right 1055198783 9:73630245-73630267 GCTTGGTCTGGACCTGCTAAAGG No data
1055198775_1055198783 11 Left 1055198775 9:73630211-73630233 CCAGATCTAGAACAGGCTCCTCC No data
Right 1055198783 9:73630245-73630267 GCTTGGTCTGGACCTGCTAAAGG No data
1055198777_1055198783 -7 Left 1055198777 9:73630229-73630251 CCTCCCCACCAGACTTGCTTGGT No data
Right 1055198783 9:73630245-73630267 GCTTGGTCTGGACCTGCTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055198783 Original CRISPR GCTTGGTCTGGACCTGCTAA AGG Intergenic
No off target data available for this crispr