ID: 1055199747

View in Genome Browser
Species Human (GRCh38)
Location 9:73646153-73646175
Sequence CCATTTCAACAGCTGGTGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055199747_1055199763 23 Left 1055199747 9:73646153-73646175 CCTGGCACCAGCTGTTGAAATGG No data
Right 1055199763 9:73646199-73646221 CAGGGCATGCACTGGGGGCATGG No data
1055199747_1055199756 15 Left 1055199747 9:73646153-73646175 CCTGGCACCAGCTGTTGAAATGG No data
Right 1055199756 9:73646191-73646213 CCCCCTCACAGGGCATGCACTGG No data
1055199747_1055199758 16 Left 1055199747 9:73646153-73646175 CCTGGCACCAGCTGTTGAAATGG No data
Right 1055199758 9:73646192-73646214 CCCCTCACAGGGCATGCACTGGG No data
1055199747_1055199751 4 Left 1055199747 9:73646153-73646175 CCTGGCACCAGCTGTTGAAATGG No data
Right 1055199751 9:73646180-73646202 AGTTCCCTTGTCCCCCTCACAGG 0: 17
1: 89
2: 199
3: 283
4: 445
1055199747_1055199760 17 Left 1055199747 9:73646153-73646175 CCTGGCACCAGCTGTTGAAATGG No data
Right 1055199760 9:73646193-73646215 CCCTCACAGGGCATGCACTGGGG No data
1055199747_1055199762 18 Left 1055199747 9:73646153-73646175 CCTGGCACCAGCTGTTGAAATGG No data
Right 1055199762 9:73646194-73646216 CCTCACAGGGCATGCACTGGGGG No data
1055199747_1055199752 5 Left 1055199747 9:73646153-73646175 CCTGGCACCAGCTGTTGAAATGG No data
Right 1055199752 9:73646181-73646203 GTTCCCTTGTCCCCCTCACAGGG 0: 34
1: 108
2: 200
3: 176
4: 335

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055199747 Original CRISPR CCATTTCAACAGCTGGTGCC AGG (reversed) Intergenic
No off target data available for this crispr