ID: 1055200205

View in Genome Browser
Species Human (GRCh38)
Location 9:73649571-73649593
Sequence CAGCAGTGCCGGACAGGCCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 237
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 215}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055200205_1055200210 27 Left 1055200205 9:73649571-73649593 CCATGGCCTGTCCGGCACTGCTG 0: 1
1: 0
2: 1
3: 20
4: 215
Right 1055200210 9:73649621-73649643 TGCCCCTCACTGGCCAAATGTGG 0: 1
1: 0
2: 2
3: 22
4: 388
1055200205_1055200209 17 Left 1055200205 9:73649571-73649593 CCATGGCCTGTCCGGCACTGCTG 0: 1
1: 0
2: 1
3: 20
4: 215
Right 1055200209 9:73649611-73649633 TTTATCATTGTGCCCCTCACTGG 0: 1
1: 2
2: 1
3: 14
4: 139

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055200205 Original CRISPR CAGCAGTGCCGGACAGGCCA TGG (reversed) Intergenic
900321557 1:2086874-2086896 CAGCAGACCCAGCCAGGCCAGGG + Intronic
900987424 1:6081229-6081251 CAGCAGTGCCGCTCAGGGCCGGG + Intronic
901138030 1:7010147-7010169 CAGCAGTGTCCTGCAGGCCATGG - Intronic
901647235 1:10723255-10723277 CAGTGGTGATGGACAGGCCAGGG - Intronic
901648573 1:10729447-10729469 CATCTGTCCCGGACAGTCCAGGG + Intronic
901975551 1:12941433-12941455 CACCAGTGCAGGACTGTCCAAGG - Exonic
901983148 1:13052567-13052589 CACCAGTGCAGGACTGTCCAAGG - Intronic
901998941 1:13176351-13176373 CACCAGTGCAGGACTGTCCAAGG + Intergenic
904591865 1:31619398-31619420 CAGCACTGCCGGGCAAGCCCTGG - Intronic
905345453 1:37308253-37308275 CAGCAGTGCATGAAAGGCCCAGG + Intergenic
905826122 1:41027396-41027418 CAGCAGTTCTGGCCAGGGCAAGG + Exonic
905918810 1:41705274-41705296 CATCATTGCAGGCCAGGCCAGGG - Intronic
906197080 1:43936109-43936131 CAGCAGAGCCAGAGCGGCCAGGG - Exonic
907666775 1:56439839-56439861 CAGCTGTCCCGGGCATGCCAGGG - Intergenic
909601494 1:77466071-77466093 CAGCAGAGCCTCACGGGCCATGG - Intronic
910259753 1:85283848-85283870 CAGCTGTGCCTGAGAGGGCAGGG - Intergenic
912437781 1:109673969-109673991 CAGCAGGGCTGGAGATGCCATGG + Intronic
912440290 1:109692428-109692450 CAGCAGGGCTGGAGATGCCATGG + Intronic
915580186 1:156808796-156808818 CAGCAGGGCCGTGAAGGCCAAGG + Intronic
915600801 1:156922116-156922138 CAGCAGTGCCTGAGAGGTTAGGG + Intronic
922380383 1:225017695-225017717 CAGCTGGGCTGGAGAGGCCAAGG - Intronic
1062817396 10:510526-510548 CAGCCGTGCCAGGCAGGCCTGGG + Intronic
1063451492 10:6153322-6153344 CAGCAGTGCCCAGTAGGCCAGGG + Intronic
1064777564 10:18795871-18795893 CAGCAGAGCTGGAAGGGCCAAGG - Intergenic
1067045916 10:42985129-42985151 CAGCAGGGCCTGACAGGCAGTGG - Intergenic
1067462212 10:46466086-46466108 CTGCAGTTCCGGGCAGGCCTTGG - Intergenic
1067624984 10:47918512-47918534 CTGCAGTTCCGGGCAGGCCTTGG + Intergenic
1070381614 10:75885163-75885185 CAGCAATGCCTGAGAGGCCTTGG - Intronic
1070724437 10:78778656-78778678 GTGCAGAGCCGGACAGGACAGGG - Intergenic
1071499745 10:86194896-86194918 CAGCAGTTCCTGTCAGGGCAGGG + Intronic
1071602058 10:86963118-86963140 CAGCACAGGTGGACAGGCCAAGG - Exonic
1075167166 10:120079226-120079248 CAGCAGTGTAGGACAGGCACAGG + Intergenic
1076314392 10:129530717-129530739 CAGCAGGACCGGCCTGGCCATGG + Intronic
1076692957 10:132233094-132233116 CAGCAGGGCGGGACAGGGCAAGG + Intronic
1077256098 11:1584081-1584103 CAGCCCTGCAGGACAGCCCAGGG - Intergenic
1081031149 11:38085133-38085155 GAGCAGGTCCGGACAGGGCATGG - Intergenic
1083278319 11:61610148-61610170 CAGCAGAGCCTGACACGCCGTGG - Intergenic
1083596650 11:63920861-63920883 AAGGAGTGCCGGCTAGGCCAGGG - Intergenic
1083768258 11:64852589-64852611 CAGCAGAGCAGGACTGGGCAGGG + Exonic
1084375472 11:68773909-68773931 CAGCAGTGCTAGACAGGCAAGGG + Intronic
1084480756 11:69418720-69418742 CAGCAGAGCCGGACCTGCCCTGG - Intergenic
1087264092 11:96042224-96042246 CAGCACTTTCGGAGAGGCCAAGG - Intronic
1089140404 11:116279548-116279570 CTGCAGTGCCACACAGGCCTGGG - Intergenic
1092877345 12:12859836-12859858 CAGGAGTTCCAGACAGGCCTGGG - Intergenic
1094039669 12:26109767-26109789 CAGCAGTGCAGGCCAAGCGAAGG + Intergenic
1095669866 12:44846307-44846329 CAGCATTGCCAGACAGTCTATGG + Intronic
1095982886 12:47982865-47982887 CAGGAGTGCCGGGGAGGCCACGG + Exonic
1096870151 12:54587990-54588012 CAGCAGTGCGGGAGGGGCCTGGG - Intronic
1100581039 12:95940786-95940808 CAGCAGTGCCTTAAAGGTCAAGG - Intronic
1101345623 12:103883398-103883420 CTGCAGGGCCAGACAGACCAAGG + Intergenic
1102059368 12:109921182-109921204 CTGCAGGGCCGGTCAGGACAGGG - Intronic
1102489971 12:113284660-113284682 CAGGTGTGCCGGCCAGGACACGG - Intronic
1102987887 12:117293331-117293353 CATCTGTGCAGGACAAGCCACGG + Intronic
1103380653 12:120491616-120491638 CAGTAGTGAGGAACAGGCCACGG + Intronic
1104571034 12:129926264-129926286 CAGGAGTTCCAGACAGGCCTGGG + Intergenic
1106620082 13:31364507-31364529 CATCAGTGCCCCACAGGCCACGG + Intergenic
1108582267 13:51837681-51837703 CAGCAGTGCAGGAAACGTCATGG + Intergenic
1112965743 13:105190989-105191011 CTGCAGTGCTGGAGAGGCCTCGG - Intergenic
1113072049 13:106431492-106431514 CAGGAGTTCAGGACAGGCCTGGG + Intergenic
1114533642 14:23410093-23410115 AAGCAGTGACGCACTGGCCATGG - Intergenic
1115268623 14:31527273-31527295 CAGCAGTGCCGGCCCGCCCGTGG - Intronic
1119255708 14:73194467-73194489 CAGGAGTTCCGGACAAGCCTGGG - Intronic
1121282226 14:92707181-92707203 CAGCAGTTCCAGACCGGCCTGGG + Intronic
1122046399 14:99027072-99027094 CAACAGATCCAGACAGGCCAGGG + Intergenic
1122690220 14:103528753-103528775 CAGCAGTGACAGCCAGGCCTTGG + Intergenic
1122941238 14:104982297-104982319 AAGCAGCGCCAGTCAGGCCATGG - Intergenic
1123010614 14:105347951-105347973 CAGGAGTGCTGGAGACGCCAGGG - Intronic
1126100967 15:45117960-45117982 AAGCAGTGCCCGCCAGGCCTGGG + Exonic
1126252738 15:46588075-46588097 CAACAGTGGTGGACAGGACAAGG + Intergenic
1126718673 15:51552185-51552207 CAGCAGAGCCTCACAGGCCATGG + Intronic
1127047578 15:55043265-55043287 CAGCAGTGGTGGACAGAACAGGG + Intergenic
1128599438 15:68983312-68983334 CAGCTGTGCAGGACAGTCCCAGG - Intronic
1128727468 15:69998778-69998800 CAGCACTCACGGCCAGGCCAGGG + Intergenic
1130159570 15:81385276-81385298 CAGCAGTGACAGACATGGCATGG + Intergenic
1130651335 15:85763781-85763803 CAGCAGTGGGGATCAGGCCAAGG - Intronic
1130689303 15:86066699-86066721 CAGCACTGCAGGTCTGGCCACGG + Intergenic
1131720604 15:95164582-95164604 AAACAGTGCCGGACTGGACATGG - Intergenic
1132397113 15:101482192-101482214 AACCAGTGACTGACAGGCCAGGG - Intronic
1132471265 16:104759-104781 CAGGAGTGCCCCAAAGGCCATGG + Intronic
1132542265 16:516051-516073 CTGCACTGCCGGGGAGGCCACGG - Intronic
1132942809 16:2516561-2516583 CGTCAGTGCCAGGCAGGCCAAGG - Intronic
1133268662 16:4599975-4599997 TAGAAGTGCTGTACAGGCCATGG - Intronic
1133275231 16:4634255-4634277 CAGCAGGGAGGGACAGGCCCTGG + Intronic
1133398953 16:5470745-5470767 CTGCAGAGGCGGACAGACCAGGG - Intergenic
1133570766 16:7037874-7037896 CAGCAGAGACACACAGGCCATGG - Intronic
1135116284 16:19726202-19726224 CAGGAGTTCCGGACTGGGCACGG - Intronic
1135135808 16:19884880-19884902 CAGCAGCGCGGGCCGGGCCAGGG - Exonic
1135709034 16:24699507-24699529 CAGGAGTGCCAGACAAGCCTGGG + Intergenic
1135875724 16:26198348-26198370 CAGCAGAGCCGGCCAGGTGAGGG - Intergenic
1136078249 16:27831685-27831707 GAGCAGAGCCAGACAGGCAATGG + Intronic
1136555115 16:31003074-31003096 CAGCAGTGCCCCACAGCCCCAGG + Intronic
1137491857 16:48939504-48939526 GAGTAGTGCTGGACTGGCCAAGG - Intergenic
1138738611 16:59280813-59280835 CAGCAGTGATGGACAGGCCAAGG - Intergenic
1141157119 16:81605098-81605120 GAGCACTGCCGGAGAAGCCAGGG - Intronic
1141856308 16:86683495-86683517 AAGCAGCTCCGGCCAGGCCATGG + Intergenic
1142140176 16:88469238-88469260 CTGAAGTGCCGGCCGGGCCAGGG + Intronic
1142608437 17:1095149-1095171 CAGCAGTCCCAGGAAGGCCAAGG + Intronic
1147018326 17:37510366-37510388 CAGCAGTGCCGGACATTTCGCGG + Intronic
1151940077 17:77286776-77286798 CATCAGTGCAGGCCCGGCCAGGG + Intronic
1152000994 17:77645152-77645174 CAGCAGAGCCCGGGAGGCCAGGG - Intergenic
1156479577 18:37427544-37427566 CTGCAGAGAGGGACAGGCCAGGG - Intronic
1158584745 18:58721979-58722001 CAGCAGTGACAGAAATGCCAGGG - Intronic
1160522592 18:79516560-79516582 CAGCAGTGTCGGACAGTTTAGGG + Intronic
1160812716 19:1019946-1019968 CAGCCGTGCAGGACAGGCATCGG - Intronic
1160909330 19:1467597-1467619 CACCTCTGCCAGACAGGCCATGG + Exonic
1160995953 19:1881943-1881965 GTGCAGTGCCTGACAGGCCGTGG - Intronic
1161516137 19:4697682-4697704 GAGCAGCGCCGGGCAGGCCAGGG - Intronic
1161977652 19:7615353-7615375 CCGCGGTGGCAGACAGGCCAAGG - Intronic
1162745350 19:12794743-12794765 CAGCAGTTCCAGACCAGCCAGGG - Intronic
1163569225 19:18070415-18070437 CAGTGGCGCCGGTCAGGCCAGGG - Intronic
1163704044 19:18802105-18802127 CAGCAGTTCCAGACTGGCCTGGG + Intergenic
1164931305 19:32178232-32178254 CAGCAGTTCCAGACCGGCCTGGG - Intergenic
1167497504 19:49828261-49828283 CACCAGTCCCAGACAGGACAGGG - Intronic
1168639255 19:58019917-58019939 CTGCAGTGCCTGGCAGGCCGAGG - Intergenic
926312328 2:11683707-11683729 CGGCAGTGCAGGGCAGGGCAGGG - Intronic
927095129 2:19742580-19742602 CTGCAGTGCTAGAGAGGCCACGG + Intergenic
927933332 2:27059680-27059702 AAGCAGTGCCAAACAGGACATGG + Intronic
928283178 2:29966438-29966460 CAGCAGGACTGGGCAGGCCAGGG - Intergenic
928455664 2:31419119-31419141 CAGCAGAGACTTACAGGCCAGGG - Intergenic
929595576 2:43173589-43173611 CAGGACTGCAGGACAGGCCATGG + Intergenic
930102315 2:47612962-47612984 CAGGAGGACTGGACAGGCCATGG + Intergenic
930354594 2:50301674-50301696 CAGCAGTAGCTGACATGCCAGGG - Intronic
932130575 2:69183623-69183645 CAGGAGTGCAAGACAGGCCTGGG - Intronic
932769361 2:74491999-74492021 CAGCAGTCCCGGAGATGCCTGGG - Exonic
934947607 2:98553144-98553166 CCGCAGAGCTGGACAGACCAAGG + Intronic
938297393 2:130186697-130186719 CAGCAGTTCAGGACTAGCCAGGG + Intronic
938308008 2:130267750-130267772 CAGCAGTGATGGGCAGGCCAGGG + Intergenic
938459382 2:131487973-131487995 CAGCAGTTCAGGACTAGCCAGGG - Intronic
940567392 2:155384724-155384746 CAGCAGTCCAGGGCAGGGCAGGG + Intergenic
946164014 2:217852956-217852978 CATCAGGGCTGGACAGGCCTGGG - Intronic
948574597 2:238941533-238941555 CAGCTGGGCCCCACAGGCCAGGG + Intergenic
1168750870 20:280073-280095 CAGCATTTCCGGGCAGGCCGCGG + Intronic
1170517500 20:17147045-17147067 CCCCAATGCCCGACAGGCCATGG - Intergenic
1172648656 20:36487596-36487618 GAGCAGGGCGGGACAGTCCAAGG - Intronic
1175942038 20:62541880-62541902 CAGCAGTGCTGGACTGGGGAGGG + Intergenic
1176086046 20:63296005-63296027 CACCAGGGCCTGACAGGCCGGGG + Intronic
1176247497 20:64104442-64104464 CAGCAGGGGTGTACAGGCCATGG + Intergenic
1176247534 20:64104579-64104601 CAGCAGGGGAGCACAGGCCATGG + Intergenic
1177374541 21:20252582-20252604 CAGCCGAGCAGGAAAGGCCAAGG + Intergenic
1178552188 21:33550529-33550551 CAGCAGTGCCTGAGTTGCCAGGG + Exonic
1178562153 21:33648635-33648657 CAGGAGTTCCAGACTGGCCAGGG + Intronic
1178608125 21:34056832-34056854 CAGCAGTGCTGAGCAGGCCTCGG - Intergenic
1179933270 21:44586097-44586119 CAGGAGAGCCAGGCAGGCCAGGG - Intronic
1180001567 21:44997647-44997669 CAGCTGTGCGGGGCAGGCCCTGG + Intergenic
1180014346 21:45073026-45073048 CCGCAGTCCCGGACAGGTCAGGG - Intergenic
1182615559 22:31586794-31586816 CAACACTGGCGGACAGTCCAGGG + Intronic
1183079850 22:35449410-35449432 CAGCAGGGACAGAGAGGCCATGG - Intergenic
1183184281 22:36282813-36282835 CAGCGGGCCCGGCCAGGCCAGGG + Intronic
1183746604 22:39695321-39695343 CAGCTGTGACGGGCAGGCCATGG + Intergenic
1184656052 22:45942548-45942570 CAGCAGGGCCAGGCAGGCGAGGG - Intronic
950114248 3:10440198-10440220 CAGAAGTGCCCTACAGGACAAGG - Intronic
951492726 3:23290802-23290824 CAGCAGTTCTGGGGAGGCCAAGG + Intronic
953814635 3:46144439-46144461 CTGCAGTGCTGCCCAGGCCAGGG + Intergenic
954133361 3:48570932-48570954 CAGGAGCACCGGGCAGGCCAGGG + Exonic
955224353 3:57048881-57048903 CAGCATGGCAGGACATGCCAGGG + Intronic
955281637 3:57599900-57599922 CAGGAGTTCCAGACAGGCCTGGG - Intergenic
956165233 3:66393282-66393304 CAGCAGTTCCAGTCAGGCCTGGG + Intronic
957949719 3:87108712-87108734 CAGCAATATGGGACAGGCCAGGG + Intergenic
959086281 3:101853660-101853682 CAGCAGCGCCTGTGAGGCCATGG + Exonic
960992413 3:123320569-123320591 CAGCAGCCCCAGACAGGCCAGGG - Intronic
961552328 3:127676543-127676565 CAGCAGGGCCCCAAAGGCCACGG - Exonic
962266217 3:133946128-133946150 CAGAAGTGCCGTACAGACTAGGG + Intronic
962298055 3:134211887-134211909 CAGCACTGACAGAGAGGCCATGG + Intronic
962313799 3:134345413-134345435 CAGCAGAGTCAGCCAGGCCAGGG - Intergenic
962403566 3:135081577-135081599 CAGCAGTGGCGAGCAGCCCATGG - Intronic
963330565 3:143910362-143910384 CAGCATTGCTGGACATGCCATGG + Intergenic
963448065 3:145440231-145440253 CAGCATTTCTGGACATGCCATGG + Intergenic
967855912 3:194117430-194117452 CAGCAGTGCCGGAGATTACAGGG - Intergenic
968341067 3:197956201-197956223 CAGCACTTCAGGAGAGGCCAAGG - Exonic
968908246 4:3464199-3464221 CGGCAGAGCCGGCCAGGCCCGGG + Intronic
969098434 4:4751535-4751557 CAGCAGGGCCAGACAGGCGAAGG - Intergenic
969480403 4:7443902-7443924 CAGCAGCGGCAGCCAGGCCAGGG - Intronic
970742751 4:19256858-19256880 CAGGAGTGCCTCAAAGGCCAGGG - Intergenic
972619639 4:40734328-40734350 AAGCATTCACGGACAGGCCATGG + Intergenic
972933493 4:44103988-44104010 CTGCTGTGCTGGAAAGGCCAAGG + Intergenic
974880723 4:67753858-67753880 CAGCAAAGTCGGACAGTCCATGG - Exonic
975693651 4:76990455-76990477 GCCCAGTTCCGGACAGGCCACGG - Intronic
976588171 4:86822083-86822105 CAGCAGTGCCTGAGAGGGCCTGG - Intergenic
978855073 4:113385658-113385680 AAGGAGTGACAGACAGGCCAGGG - Intergenic
980180576 4:129395443-129395465 CAGCAGTGCAGGGGAGGCCCTGG - Intergenic
982679214 4:158408953-158408975 CAGAGGTGCCTAACAGGCCATGG + Intronic
985662259 5:1163193-1163215 CAGCACTGGGGGAGAGGCCATGG + Intergenic
986018721 5:3781083-3781105 AAGCAATGCCAGACAGGCCCGGG - Intergenic
991012389 5:61897942-61897964 CTTCAGTGAGGGACAGGCCATGG + Intergenic
994963077 5:106629123-106629145 CAGCAGTGCCAGAAAGGCAATGG - Intergenic
997301142 5:132806463-132806485 CAGCAGTTCCAGACAAGCCCAGG + Intronic
999266353 5:150269351-150269373 CAGCAGGGTGGGACAGGACAGGG + Intronic
999516894 5:152310682-152310704 CACCAGTTCCTAACAGGCCATGG + Intergenic
1000294430 5:159900766-159900788 GAGCAGTGCAAGACAGGCCATGG + Intergenic
1001031469 5:168266406-168266428 CAGCAGTGCCCACCAGGACAGGG + Intergenic
1006425056 6:33958588-33958610 CAGCAGTGCAGGTCATGACAGGG + Intergenic
1007179916 6:39922641-39922663 CAGAAGTGCTGGAGAGGCAAGGG + Intronic
1009266021 6:61555884-61555906 CTGCTGTGCTGGAGAGGCCAAGG + Intergenic
1011433696 6:87315282-87315304 TATCATTGCTGGACAGGCCAGGG - Intronic
1011930107 6:92701034-92701056 CAGCAGGGCTGGACCAGCCAAGG - Intergenic
1013053446 6:106559884-106559906 CAGCAGTTCCAGACAAGCCTGGG + Intronic
1015789420 6:136951424-136951446 CAGGAGTTCCAGACAAGCCAAGG - Intergenic
1019379620 7:714017-714039 CAGCAGCTCCAGGCAGGCCAGGG - Intronic
1019761287 7:2814786-2814808 GAGCAGTGCGGGGCAGGTCAGGG - Intronic
1021388894 7:20068053-20068075 AAGCAGTGACGGACAGCACATGG + Intergenic
1021600417 7:22357927-22357949 CAGCAGTGCCTTAAACGCCAGGG + Intergenic
1021682259 7:23145812-23145834 CACTCGTGCCGGACAGGTCAAGG - Intronic
1023672933 7:42598744-42598766 CTGCAGAGCAGGACAGGGCAGGG + Intergenic
1025046625 7:55697595-55697617 CAGGAGTTCCAGACAGGCCTGGG + Intergenic
1025099902 7:56125422-56125444 CAGCACAGCCGGACAGGGCCAGG + Intergenic
1026437556 7:70413039-70413061 CAGTAGTGCCAGACAGGGCATGG - Intronic
1029459588 7:100687254-100687276 GCGCAGAGCCGGGCAGGCCAGGG - Intronic
1029487305 7:100851362-100851384 GTTCAGTGACGGACAGGCCAGGG + Intronic
1029668071 7:102008640-102008662 CAGCAGAGCAGGACAGGCTGGGG - Intronic
1029745634 7:102514417-102514439 CAGTAGTGGGGGACAGCCCACGG - Intronic
1029763573 7:102613396-102613418 CAGTAGTGGGGGACAGCCCACGG - Intronic
1033593097 7:142831074-142831096 CAACACTGCAGGACAGGCCCTGG - Intergenic
1034291140 7:149932741-149932763 CAGCAGGGCGAGACAGGGCAGGG + Intergenic
1034386551 7:150745366-150745388 CAGCCATCCCGGACAGGCCATGG - Intronic
1039615109 8:38949352-38949374 CAGCAGAACGGGAGAGGCCAGGG - Intronic
1039963823 8:42269773-42269795 CAGCAGTGCCTGACAGCCCTGGG - Intergenic
1039990582 8:42484612-42484634 CAGCTTTGCAGGAGAGGCCATGG + Intronic
1040439429 8:47425456-47425478 GAGCTGTGCAGGACAGGCTATGG + Intronic
1046687736 8:117245688-117245710 CAGCTGTGGAGGACAGGGCAGGG + Intergenic
1047359953 8:124160078-124160100 AAGCAGTGCTGGAAAGGTCAGGG - Intergenic
1049439490 8:142602703-142602725 CAGCAGTCAAGGCCAGGCCAGGG + Intergenic
1049852305 8:144839351-144839373 CAGCAGAGCCAGTGAGGCCAGGG - Intronic
1054906052 9:70414227-70414249 CAGGAGGCCCGGACCGGCCACGG - Exonic
1055200205 9:73649571-73649593 CAGCAGTGCCGGACAGGCCATGG - Intergenic
1056160034 9:83880172-83880194 CAGCAGTGAAGGGCAGGTCAAGG + Intronic
1056291868 9:85151608-85151630 CAGGAGTGATGGCCAGGCCAGGG + Intergenic
1057214469 9:93220346-93220368 CACCAGTGCAGGACGGGACATGG + Intronic
1057336109 9:94156534-94156556 CAGCAGTGTCTGCCAGGCCTGGG + Intergenic
1058092683 9:100823588-100823610 CCGCATTTCCCGACAGGCCATGG + Intergenic
1059215717 9:112560147-112560169 TATCAGTGCAGGCCAGGCCAAGG - Intronic
1060224897 9:121784678-121784700 CAGCAGTCCCGGCCAGCCCTCGG - Exonic
1061849767 9:133407490-133407512 CAGCAGGGCCGGGCAGGGCAGGG + Intronic
1062139481 9:134947983-134948005 CAGCTGTGCCTGGCAGGGCAGGG - Intergenic
1188429364 X:30088832-30088854 CAGGAGTTCCAGACAGGCCTGGG + Intergenic
1196017909 X:110959094-110959116 CAGCAGTGCAGTACAGGCTATGG + Intronic
1198951507 X:142077712-142077734 ATGCAGTGCCTGACAGGCAAAGG + Intergenic
1200116112 X:153770411-153770433 CTGCAGTGCCGTCCAGGCCTTGG + Exonic