ID: 1055208578

View in Genome Browser
Species Human (GRCh38)
Location 9:73762564-73762586
Sequence TGTTAGCTGGAGAACACTGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055208578_1055208591 21 Left 1055208578 9:73762564-73762586 CCGCCAGTGTTCTCCAGCTAACA No data
Right 1055208591 9:73762608-73762630 GGAGTTCCTAGAGGAGGACCTGG No data
1055208578_1055208585 0 Left 1055208578 9:73762564-73762586 CCGCCAGTGTTCTCCAGCTAACA No data
Right 1055208585 9:73762587-73762609 GGTTTCAGGCCTCCCTGGGATGG No data
1055208578_1055208588 12 Left 1055208578 9:73762564-73762586 CCGCCAGTGTTCTCCAGCTAACA No data
Right 1055208588 9:73762599-73762621 CCCTGGGATGGAGTTCCTAGAGG No data
1055208578_1055208584 -4 Left 1055208578 9:73762564-73762586 CCGCCAGTGTTCTCCAGCTAACA No data
Right 1055208584 9:73762583-73762605 AACAGGTTTCAGGCCTCCCTGGG No data
1055208578_1055208590 15 Left 1055208578 9:73762564-73762586 CCGCCAGTGTTCTCCAGCTAACA No data
Right 1055208590 9:73762602-73762624 TGGGATGGAGTTCCTAGAGGAGG No data
1055208578_1055208583 -5 Left 1055208578 9:73762564-73762586 CCGCCAGTGTTCTCCAGCTAACA No data
Right 1055208583 9:73762582-73762604 TAACAGGTTTCAGGCCTCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055208578 Original CRISPR TGTTAGCTGGAGAACACTGG CGG (reversed) Intergenic
No off target data available for this crispr