ID: 1055212328

View in Genome Browser
Species Human (GRCh38)
Location 9:73811749-73811771
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055212328_1055212330 -7 Left 1055212328 9:73811749-73811771 CCTATGGGTGCTCTACCTAGATT No data
Right 1055212330 9:73811765-73811787 CTAGATTGTCTTTACTAACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055212328 Original CRISPR AATCTAGGTAGAGCACCCAT AGG (reversed) Intergenic
No off target data available for this crispr