ID: 1055213207

View in Genome Browser
Species Human (GRCh38)
Location 9:73824042-73824064
Sequence TGTATCATTGTATATGTGTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055213207_1055213208 -10 Left 1055213207 9:73824042-73824064 CCTAACACATATACAATGATACA No data
Right 1055213208 9:73824055-73824077 CAATGATACAACACATCATGAGG No data
1055213207_1055213209 -1 Left 1055213207 9:73824042-73824064 CCTAACACATATACAATGATACA No data
Right 1055213209 9:73824064-73824086 AACACATCATGAGGTGTGACAGG No data
1055213207_1055213210 0 Left 1055213207 9:73824042-73824064 CCTAACACATATACAATGATACA No data
Right 1055213210 9:73824065-73824087 ACACATCATGAGGTGTGACAGGG No data
1055213207_1055213211 14 Left 1055213207 9:73824042-73824064 CCTAACACATATACAATGATACA No data
Right 1055213211 9:73824079-73824101 GTGACAGGGCTCACTATCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055213207 Original CRISPR TGTATCATTGTATATGTGTT AGG (reversed) Intergenic