ID: 1055213207 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 9:73824042-73824064 |
| Sequence | TGTATCATTGTATATGTGTT AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 4 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1055213207_1055213211 | 14 | Left | 1055213207 | 9:73824042-73824064 | CCTAACACATATACAATGATACA | No data | ||
| Right | 1055213211 | 9:73824079-73824101 | GTGACAGGGCTCACTATCTGAGG | No data | ||||
| 1055213207_1055213209 | -1 | Left | 1055213207 | 9:73824042-73824064 | CCTAACACATATACAATGATACA | No data | ||
| Right | 1055213209 | 9:73824064-73824086 | AACACATCATGAGGTGTGACAGG | No data | ||||
| 1055213207_1055213210 | 0 | Left | 1055213207 | 9:73824042-73824064 | CCTAACACATATACAATGATACA | No data | ||
| Right | 1055213210 | 9:73824065-73824087 | ACACATCATGAGGTGTGACAGGG | No data | ||||
| 1055213207_1055213208 | -10 | Left | 1055213207 | 9:73824042-73824064 | CCTAACACATATACAATGATACA | No data | ||
| Right | 1055213208 | 9:73824055-73824077 | CAATGATACAACACATCATGAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1055213207 | Original CRISPR | TGTATCATTGTATATGTGTT AGG (reversed) | Intergenic | ||