ID: 1055213210

View in Genome Browser
Species Human (GRCh38)
Location 9:73824065-73824087
Sequence ACACATCATGAGGTGTGACA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055213207_1055213210 0 Left 1055213207 9:73824042-73824064 CCTAACACATATACAATGATACA No data
Right 1055213210 9:73824065-73824087 ACACATCATGAGGTGTGACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055213210 Original CRISPR ACACATCATGAGGTGTGACA GGG Intergenic