ID: 1055213211 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 9:73824079-73824101 |
Sequence | GTGACAGGGCTCACTATCTG AGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1055213207_1055213211 | 14 | Left | 1055213207 | 9:73824042-73824064 | CCTAACACATATACAATGATACA | No data | ||
Right | 1055213211 | 9:73824079-73824101 | GTGACAGGGCTCACTATCTGAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1055213211 | Original CRISPR | GTGACAGGGCTCACTATCTG AGG | Intergenic | ||