ID: 1055216800

View in Genome Browser
Species Human (GRCh38)
Location 9:73873285-73873307
Sequence GAGGGGTGCAGGTGTGCTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 397
Summary {0: 1, 1: 0, 2: 5, 3: 45, 4: 346}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055216800_1055216808 20 Left 1055216800 9:73873285-73873307 CCTGCAGCACACCTGCACCCCTC 0: 1
1: 0
2: 5
3: 45
4: 346
Right 1055216808 9:73873328-73873350 CTTCTCTCCCTGGTTTCTGATGG No data
1055216800_1055216806 10 Left 1055216800 9:73873285-73873307 CCTGCAGCACACCTGCACCCCTC 0: 1
1: 0
2: 5
3: 45
4: 346
Right 1055216806 9:73873318-73873340 TAGCCTATTTCTTCTCTCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055216800 Original CRISPR GAGGGGTGCAGGTGTGCTGC AGG (reversed) Intergenic
900231562 1:1561552-1561574 GATGGGTGCAGGGGGGCCGCGGG - Intronic
900302046 1:1982699-1982721 GAGGGCGGCAGGTGGGCTCCGGG + Intronic
900369399 1:2324682-2324704 GAGGGGCCCAGGGGTCCTGCCGG + Intronic
900463749 1:2813645-2813667 GAGGGGTGTGGGTGTGGTGCAGG + Intergenic
901930336 1:12592996-12593018 GAGGGGTCCACTTGTGCTCCAGG - Intronic
902337967 1:15764793-15764815 AAGGGGTGGGGGTGTCCTGCTGG - Intronic
902600829 1:17539518-17539540 GTGGGGGGCCGGTGGGCTGCCGG + Intergenic
902698639 1:18156781-18156803 GCAGGGTGCAGGTGTGAGGCTGG + Intronic
903707178 1:25294897-25294919 GAGGGCTGCAGGGGTGCAGCGGG + Intronic
903720061 1:25398445-25398467 GAGGGCTGCAGGGGTGCAGCGGG - Intronic
903750030 1:25616216-25616238 CCGGGCTGCAGGGGTGCTGCTGG - Intergenic
904383043 1:30124396-30124418 GAGGCCTGCAGGAGGGCTGCAGG + Intergenic
904992305 1:34602926-34602948 GAGGGGTGCAGGTGTGATGAGGG - Intergenic
910912544 1:92253150-92253172 CAGGGGTGCAGGTTTGGTACAGG - Intronic
912697975 1:111855694-111855716 CTGGGGTGGAGGTGTGCAGCAGG - Intronic
913433764 1:118825927-118825949 GAGGGTTGCAGCTTTGCTGTGGG + Intergenic
915591620 1:156874245-156874267 GGGGGATGGAGGTGGGCTGCTGG - Intronic
915619281 1:157069968-157069990 GAGGCGAGAAGCTGTGCTGCTGG + Intergenic
915622646 1:157095328-157095350 GAGGGGTGGAGGTGAGGGGCTGG + Intronic
916041317 1:160963939-160963961 GACCTGTGCAGGTGTCCTGCTGG + Intergenic
917466972 1:175288261-175288283 GAGGGAGGGAGGTGTGCTACTGG + Intergenic
921023841 1:211259748-211259770 GAGGGGGGCAGGCGGGCTGGCGG - Intronic
922271956 1:224043290-224043312 GAGGGGAGGGGGTGTGCTGGAGG - Intergenic
922279989 1:224114405-224114427 GAGGGAGGCAGGAGTTCTGCGGG - Intronic
922589505 1:226763866-226763888 GAGGGGTGCAGGTGGGGAACAGG + Intergenic
922618774 1:226978307-226978329 GAGGTGTGCAGGTGTGTGGTGGG - Intronic
922618863 1:226978681-226978703 GAGGTGTGCAGGTGTGTGGAGGG - Intronic
922818819 1:228470420-228470442 GAGGGGTGCAGGGGGAGTGCAGG + Intergenic
923461626 1:234214163-234214185 GGGCGGAGCAGGTGAGCTGCGGG + Intronic
923772063 1:236946255-236946277 GAGAGGGTCTGGTGTGCTGCGGG + Intergenic
924677411 1:246193726-246193748 GAAGTGTGCTGTTGTGCTGCTGG - Intronic
1063161334 10:3420970-3420992 GAGGGATGCAGGTAGGATGCAGG + Intergenic
1063161351 10:3421036-3421058 GTAGGGTGCAGGTGGGATGCAGG + Intergenic
1063409726 10:5828103-5828125 GAGGGTTGCAGGAGAGCTCCTGG - Intronic
1067316254 10:45166836-45166858 CTGGGGTGCAGGTGTGCAGGTGG + Intergenic
1067560935 10:47304009-47304031 AAGGAGGGCAGGGGTGCTGCGGG + Intronic
1067657346 10:48206262-48206284 GAGGACTACAGGTGTGCTACGGG - Intronic
1069737802 10:70669022-70669044 GAGGGCTGCTGGTGGCCTGCTGG + Intergenic
1070208848 10:74293910-74293932 GAGGGGTGCTTCTGGGCTGCTGG - Intronic
1071204615 10:83259777-83259799 GAGGGAGGCAGGGGTGCTACTGG - Intergenic
1071601861 10:86962367-86962389 GAGGGGTGAAGCTGGGCTCCAGG + Intronic
1072227935 10:93387426-93387448 CAGGAGGGCAGGTGTGCTGAGGG - Intronic
1072546726 10:96445761-96445783 GAGCGGGGCTGGCGTGCTGCTGG - Intronic
1072577086 10:96710105-96710127 GAGGTGTGCTGGTGTGCTGGAGG - Intronic
1072609985 10:97011483-97011505 GGAGGGTGCAGCTGAGCTGCTGG - Intronic
1074088166 10:110224421-110224443 GAGGGGTGGTGGTGTGCTACTGG + Intronic
1074232430 10:111550836-111550858 GAAGGAAGCAGATGTGCTGCTGG - Intergenic
1074314380 10:112348151-112348173 GGGAGGAGCAGGTGTGATGCCGG - Intergenic
1075717832 10:124567073-124567095 GAGGGGTGCAGGCCAGCTGAGGG + Intronic
1075718997 10:124574267-124574289 GAGGGGCACAGGTTTGCTGGGGG + Intronic
1076121351 10:127939527-127939549 GTTTGGTGCAGGTGTGCTGGAGG + Intronic
1076206956 10:128611288-128611310 GAGGTGTCCAGGTGGGCTGCAGG + Intergenic
1076509552 10:131002712-131002734 GAGGGGAGCAGCAGTGCTGTGGG + Intergenic
1076824853 10:132961707-132961729 CAGGGGAGCAGGTGTGCAGCAGG - Intergenic
1076830586 10:132992379-132992401 GGTGGGTGCAGGGGTGCTGGTGG + Intergenic
1077217432 11:1400798-1400820 GAGGGGTGCAGATGAGGAGCCGG + Intronic
1077289190 11:1781047-1781069 GAGGGTGGCAGCTGTGATGCTGG + Intergenic
1077394621 11:2314974-2314996 GAAGGGTGCAGGCGTCCTGGGGG + Intronic
1078094768 11:8289996-8290018 GAAGAATGTAGGTGTGCTGCTGG - Intergenic
1078105339 11:8354816-8354838 GAGGGGGCCAGGTGGGTTGCTGG + Intergenic
1081915333 11:46726870-46726892 CCTGGGGGCAGGTGTGCTGCTGG + Intronic
1083324310 11:61865717-61865739 AAGGGGTGCAGGTGGGGTGATGG + Exonic
1083626000 11:64072254-64072276 GATGGGTACAGGGGTGATGCCGG + Intronic
1083640996 11:64145254-64145276 GAGGGGCCCAGGTGTGCGGCGGG - Intronic
1083734300 11:64670874-64670896 GAGGGGCTCAGGTGGGCTGAAGG - Intronic
1083888028 11:65582158-65582180 GAGGGGGCCAGGGCTGCTGCAGG + Exonic
1084360760 11:68667315-68667337 GAGGGGTGCAGGAGAGATGAGGG + Intergenic
1084360788 11:68667441-68667463 GAGGGGTGCAGGAGAGGTGAGGG + Intergenic
1084585739 11:70061110-70061132 GAAGGGTGCATGTATGCTGATGG + Intergenic
1085308849 11:75504128-75504150 GATGGGTGCAGGTGAGCTGTGGG + Intronic
1085402634 11:76243775-76243797 GAGGGGCAAAGGTTTGCTGCTGG + Intergenic
1085531900 11:77196922-77196944 GAGGGGTGCTGCTGTGCTCTTGG - Intronic
1086319382 11:85628643-85628665 AAGGGATTCAGGTGTGGTGCCGG + Exonic
1087262473 11:96026241-96026263 CAGGGCTGCAGGTATACTGCTGG - Intronic
1089048556 11:115525968-115525990 GTGGGGAGAAGGTGTGCTCCAGG - Intergenic
1089194777 11:116687861-116687883 AAGGGGTTCAGGCCTGCTGCTGG - Intergenic
1089700175 11:120239996-120240018 GAGGGGGCCGGGGGTGCTGCCGG - Intronic
1090023430 11:123147611-123147633 GTGGGTTGCAGGTGTGCTATGGG - Intronic
1090198781 11:124839430-124839452 GCGGGGAGCAGGTGTGAAGCGGG + Intergenic
1091993576 12:4975613-4975635 GATGGGTACAGCAGTGCTGCAGG + Intergenic
1096581357 12:52587619-52587641 GAGGAGTGCAGGTGAGGGGCCGG - Exonic
1101259444 12:103013543-103013565 TAGGTGTGCAGGGGTGCAGCAGG + Intergenic
1101672190 12:106885841-106885863 GAGGGGTGTGTGTGTGATGCTGG + Intronic
1101803397 12:108042385-108042407 CAGGAGTGCAGGTGTGCTCCAGG + Intergenic
1101985433 12:109442368-109442390 CAGGGGTGCAGCTGGGCAGCTGG + Intronic
1103165491 12:118766894-118766916 GAGGGGTGGAGGTAGGGTGCTGG + Intergenic
1103624466 12:122207347-122207369 GAGGGGCTCAAGTGTGCAGCTGG + Exonic
1104203513 12:126614881-126614903 AAGGGGTGCAGGGGTGGTGGAGG + Intergenic
1104402049 12:128484370-128484392 GAGGGTAGCAGGTGTCCAGCAGG + Intronic
1104876412 12:132038140-132038162 GGAGGGTGCAGGTGTTCCGCCGG - Intronic
1106318756 13:28618807-28618829 TAGGGGTTCAGCTGTCCTGCCGG + Intergenic
1106558255 13:30828415-30828437 GAGAGGTGCTAGTGTGCAGCTGG - Intergenic
1107033737 13:35879538-35879560 GAGGTCTGCAGGTGTCCTGAGGG + Intronic
1108387690 13:49916204-49916226 GAGGAATGCAGCTGTGGTGCGGG + Intronic
1109273955 13:60283693-60283715 GTTGGGGGCATGTGTGCTGCCGG + Intergenic
1112972140 13:105273699-105273721 GAGGGCAGCAGGTGTGGTGGTGG + Intergenic
1113472867 13:110559195-110559217 TGGGGGTGCAGGTGTGCAGAGGG - Intronic
1113676266 13:112209797-112209819 GCAGGGTGCAGGTGGGGTGCAGG + Intergenic
1113676290 13:112209863-112209885 GTGGGGTGCAGGTGAGGTGCAGG + Intergenic
1114066775 14:19066772-19066794 GAGGGATGCTGGTCTGCTGTTGG - Intergenic
1114095491 14:19333255-19333277 GAGGGATGCTGGTCTGCTGTTGG + Intergenic
1114438288 14:22726263-22726285 GAGGGGAGCAGGTTTCCTGTTGG + Intergenic
1117547512 14:56805327-56805349 GAGGGGTGCGGGAGTGCAGCAGG + Intronic
1117668578 14:58082302-58082324 GAGAGGAGCAGGTGAGCCGCTGG - Intronic
1119330036 14:73786959-73786981 CTGGGGTGCCGGGGTGCTGCAGG - Intronic
1119378392 14:74213423-74213445 CAGGCCTGCAGGTGTCCTGCAGG + Intergenic
1119588281 14:75859278-75859300 GGAGGTTGCAGGTATGCTGCAGG + Intronic
1119735406 14:76978243-76978265 GAGGGGTGAGGGTGAGCTGAGGG - Intergenic
1120171064 14:81247655-81247677 GTTGGGGGCAGGGGTGCTGCAGG + Intergenic
1120642635 14:87033496-87033518 GAGGCATGCAGGAGTGGTGCTGG + Intergenic
1121289687 14:92763812-92763834 CAGGCATGCAGGTGTGCTGGAGG + Intergenic
1121291507 14:92779689-92779711 CAGGCGTGCAGGTGTGCTGGAGG - Intergenic
1121304591 14:92898146-92898168 GAGGGGTGCAGGCAGGCTGTGGG + Intergenic
1121726724 14:96157658-96157680 AAGGGGTTGTGGTGTGCTGCAGG - Intergenic
1122884960 14:104706873-104706895 GTGGGGTGCAGGTCAGCAGCCGG - Intronic
1123435287 15:20249734-20249756 GAGGGGTGCAGGCCTGCAGAGGG - Intergenic
1127982549 15:64045761-64045783 GCGGCCAGCAGGTGTGCTGCAGG - Intronic
1128757090 15:70190469-70190491 CGGCGGTGCAGGCGTGCTGCCGG + Intergenic
1128778450 15:70341829-70341851 GAGGGTTGAATGTGTCCTGCAGG - Intergenic
1129320076 15:74769812-74769834 GAGGGTTGCAGGTGTGCCAAAGG + Intergenic
1129669393 15:77598712-77598734 GTGGGTTGCTGGTGAGCTGCTGG + Intergenic
1130141095 15:81227082-81227104 GAGGGGTGTAGGAGGGCTGTGGG + Intronic
1130156444 15:81354597-81354619 AAGGGGTACATGTGTGCAGCTGG + Intronic
1132302927 15:100787674-100787696 GAAGGCAGCAGGTGTGGTGCTGG - Intergenic
1132701347 16:1223473-1223495 GGAGGGTGCACGTGTGCGGCGGG - Exonic
1134042638 16:11080267-11080289 GGTGGGTGCAGGTGCTCTGCTGG + Intronic
1134195652 16:12157097-12157119 GATGGCTGCAGGTGGGCAGCCGG + Intronic
1135046902 16:19163361-19163383 GAGAGATGCAGGTGTGCTGCAGG - Intronic
1136994178 16:35176835-35176857 AAGGAGGGCAGCTGTGCTGCTGG - Intergenic
1138521842 16:57575610-57575632 GAGGGTGGCAGGCCTGCTGCTGG + Exonic
1138594491 16:58022576-58022598 GAGGGGGGCAGGTGTGAGGTAGG + Intergenic
1138598738 16:58042862-58042884 GAGGGCTGCAGGTGTGCTCCAGG + Intronic
1139653597 16:68374729-68374751 GAGGGCTGCAGGTTTGCTGGGGG - Intronic
1141582670 16:85011154-85011176 GAAGGTCGCAGGTGTGCGGCGGG + Intronic
1142199249 16:88753300-88753322 GGGGGCGGGAGGTGTGCTGCGGG - Intronic
1142199257 16:88753320-88753342 GGGGGTGGCAGGTGTGCTCCGGG - Intronic
1142431717 16:90032139-90032161 GTGTGGTACAGGTGTGGTGCAGG + Intronic
1142645175 17:1307099-1307121 AAGGGGTGAAGGTGTCCAGCTGG + Intergenic
1143622208 17:8087173-8087195 GAGGGGTGAAGGTGCGCAGGGGG - Intronic
1143958882 17:10697762-10697784 TAGGGGTCCAGGTGCGCGGCTGG + Intronic
1144848077 17:18230384-18230406 GAGGGTGGCAGGTGGGCTGGGGG + Intronic
1144891100 17:18494797-18494819 GAGGGGTGAAGGGTTGGTGCAGG - Exonic
1144995445 17:19265003-19265025 GAAGGGGGCAGGTGTGGAGCTGG + Intronic
1145141123 17:20449521-20449543 GAGGGGTGAAGGGTTGGTGCAGG + Intronic
1146126791 17:30237134-30237156 GAGGGGTGCAGGGGGGATGCCGG + Intergenic
1146280290 17:31540248-31540270 GCGGGGTGCAGGGGAGGTGCTGG + Intergenic
1146791876 17:35755571-35755593 AATGGGGGCAGGGGTGCTGCTGG - Intronic
1147998701 17:44375498-44375520 GAGGGGTCCGGGTGTGCTGTGGG - Intronic
1148072648 17:44917018-44917040 GAGGGGGGCTGGGGTGCGGCGGG + Intergenic
1151319652 17:73344860-73344882 GAAGCGTGCAGGTTTGCAGCTGG - Intronic
1152235472 17:79136205-79136227 GTGGGGTGCACGCGTACTGCGGG - Intronic
1152336142 17:79701121-79701143 GAGGGGTGCAGGTGAGAGGGTGG + Intergenic
1152643528 17:81458764-81458786 GTGGGGTGCAGGCGGGGTGCAGG - Intronic
1152778324 17:82215622-82215644 GAGGGGTGCTGCAGTGCTGGGGG - Intergenic
1152798411 17:82320032-82320054 GGGTGGTGCAGGTTTTCTGCTGG + Intergenic
1152809295 17:82374024-82374046 GGGGGGGGCAGGGGTCCTGCTGG + Intergenic
1152853372 17:82649862-82649884 TAGGAGATCAGGTGTGCTGCAGG - Intergenic
1153834520 18:8951949-8951971 GGGCGGTGCAGGGGTGCAGCAGG - Intergenic
1160302531 18:77697460-77697482 GAGGGGTGCAGCTCTGGTCCGGG - Intergenic
1160456512 18:79006060-79006082 GAGGGCTGCACGTGGGCTGCAGG - Intergenic
1160511286 18:79454882-79454904 GAGGGGTGCAGGTGTGAAGGTGG - Intronic
1160778241 19:866543-866565 GAGGGGTGCAGGCCTGCGGCGGG - Intergenic
1160778258 19:866594-866616 GAGGGGTGCAGGCCCGCGGCGGG - Intergenic
1160778275 19:866645-866667 GAGGGGTGCAGGCCCGCGGCGGG - Intergenic
1160778292 19:866696-866718 GAGGGGTGCAGGCCCGCGGCGGG - Intergenic
1160778309 19:866747-866769 GAGGGGTGCAGGCCCGCGGCGGG - Intergenic
1160857502 19:1224084-1224106 GAGGGGCCCAGGAGTGCTGAGGG - Intronic
1160889416 19:1369358-1369380 GAGGGGTGGAGCTGGGCAGCAGG + Intronic
1161082669 19:2319276-2319298 GAGGGGTGCAGCGGTGAGGCAGG + Intronic
1161139141 19:2637626-2637648 GTGGTGAGCAGGTGTGGTGCCGG - Intronic
1161290223 19:3490207-3490229 GGGGGGTGGGGGTGTGCAGCTGG - Intergenic
1162803230 19:13122525-13122547 GGGGGGGGGGGGTGTGCTGCTGG + Intronic
1163596225 19:18222470-18222492 GAGGGGTGCAGGGTTCCTGAGGG - Intronic
1165117822 19:33539514-33539536 GGTGGGTGCAGGGGTGCTGGTGG - Intergenic
1166118554 19:40670693-40670715 GGAGTCTGCAGGTGTGCTGCGGG + Intronic
1166631150 19:44409182-44409204 GAGGGTTGCAAGGATGCTGCTGG + Intergenic
1166632027 19:44415309-44415331 GAGGGTTGCAAGGATGCTGCTGG + Intergenic
1166632455 19:44418994-44419016 GAGGGTTGCAAGGATGCTGCTGG + Intronic
1166636887 19:44458454-44458476 GAGAGCTGCGGGTGAGCTGCTGG + Intergenic
1166637024 19:44459399-44459421 GAGGGTTGCAAGGATGCTGCTGG - Intergenic
1166836693 19:45671473-45671495 GAGGGGTGCAGGTGAGCTGTGGG - Intronic
1166936240 19:46334940-46334962 GTGGGGTGCTGGGGTCCTGCAGG - Exonic
1167090599 19:47341245-47341267 GCGGGGTGCAGGTGGCCTGTGGG + Exonic
1167320917 19:48796761-48796783 GAGAGGTGGAGGTCTGCAGCAGG - Intronic
925119878 2:1409950-1409972 GTGGGGGGCAGGTGTGGTGGGGG + Intronic
925285827 2:2715213-2715235 GAGGGGTACAGATGCGCTGCGGG + Intergenic
926180049 2:10634429-10634451 GTGGGGTGCAGGTGGGGAGCTGG + Intronic
926301974 2:11611198-11611220 CAGGGGTGTGGGGGTGCTGCTGG - Intronic
929976323 2:46639069-46639091 TGGAGGTGGAGGTGTGCTGCTGG - Intergenic
930112253 2:47688640-47688662 GAGGAATCCAGCTGTGCTGCTGG + Intergenic
932001848 2:67892588-67892610 GAGGGATGCAGCTATACTGCTGG + Intergenic
934515124 2:94981515-94981537 GAGGGGTGCAGGTGGGGTCGGGG + Intergenic
934949288 2:98565520-98565542 GAGGGGTGCAGGTGTGGCTCTGG - Intronic
935401225 2:102662560-102662582 GAGGGGTCCAGGAGGGCTCCTGG + Intronic
935726790 2:106030606-106030628 CAGGGGTGCTGGGGAGCTGCGGG + Intergenic
936059171 2:109283307-109283329 CAGGGGAGCAGGTGTCCAGCAGG - Intronic
936397902 2:112142997-112143019 GAGGGGAGGCTGTGTGCTGCAGG + Intronic
937150515 2:119682839-119682861 GAGGGGTGGAGGTGGGCAGTGGG + Intronic
937273952 2:120672437-120672459 GAGGGGTGGTGGGGTGCTGGGGG - Intergenic
937453844 2:122024780-122024802 GTGGGGTGCAGCTGGGCTGCAGG - Intergenic
937961697 2:127464941-127464963 GTGGGCAGCAGCTGTGCTGCGGG - Intronic
938246087 2:129779105-129779127 GACGCGTGCAGGGGTGCTGCTGG + Intergenic
938484173 2:131686867-131686889 GAGGGATGCTGGTCTGCTGTTGG - Intergenic
938540996 2:132283388-132283410 GAGGGTTGCAAGGATGCTGCTGG - Intergenic
938730543 2:134143625-134143647 GAGGGGTGGAAGGGTGGTGCTGG + Intronic
940286462 2:152037846-152037868 GGGGGGAGCAGCAGTGCTGCAGG - Intronic
940896862 2:159089403-159089425 GAGGGGTGGAGGTGGGGTGCAGG - Intronic
941099481 2:161280937-161280959 GAGGGTTGCAAGGATGCTGCTGG + Intergenic
942061452 2:172231932-172231954 GAGGGGTGCAGGTGTGTGTTTGG - Intergenic
942482906 2:176407884-176407906 GAGGGCTGCATGTGGACTGCAGG + Intergenic
942491119 2:176490570-176490592 GAGGGGAGCAGCTGTGAGGCCGG - Intergenic
943547878 2:189303689-189303711 GAGTGGTTGAAGTGTGCTGCTGG - Intergenic
944976894 2:205064269-205064291 GAGAGATGCAGCTGTGCTTCAGG + Intronic
945940278 2:215942388-215942410 GAGGGGCGCAGGGGTGCCTCAGG - Intergenic
946440823 2:219693676-219693698 AGAGGGTGCAGGTGTGCTGTAGG + Intergenic
947944891 2:234092914-234092936 AAGGAGGGCAGGTGTGTTGCAGG - Intergenic
948554459 2:238797790-238797812 GAAGAGAGCAGGTGTGATGCAGG + Intergenic
948831904 2:240602411-240602433 GAGGGGTCCAGGAGGGCTGAGGG - Intronic
948916147 2:241035899-241035921 GGGGGGTGCAGGCGTGCCACGGG + Intronic
948916161 2:241035932-241035954 GGGGGGTGCAGGTGTGCCACGGG + Intronic
1169263638 20:4154859-4154881 GGGTGGTGCAGGTGGGCTGGGGG + Intronic
1170542344 20:17402146-17402168 GAGGAGTGCAGCTGTATTGCAGG - Intronic
1171869905 20:30516393-30516415 GAGGGTTGCAAGGGTGCTGCTGG - Intergenic
1172448331 20:35004576-35004598 GAGGGAGGCAGGGGTGCAGCAGG + Intronic
1174395520 20:50244529-50244551 GAAGGGTGCGGGTGTGCTGGTGG + Intergenic
1175052428 20:56167693-56167715 GTGGGGGGCAGGGGTGCTCCTGG + Intergenic
1175458635 20:59134187-59134209 GAGGGGAGCAGGGGATCTGCTGG - Intergenic
1175703769 20:61160412-61160434 GAGGGGTGGGTGTGTGCTGGAGG - Intergenic
1175861654 20:62153496-62153518 GGGGAGCGCAGGTGTGCAGCGGG - Intronic
1175918430 20:62438441-62438463 CAGTGGTGCAGGAGGGCTGCCGG + Intergenic
1176026121 20:62986468-62986490 TAGGGGTGCAGGTGTGCAGGGGG + Intergenic
1176139338 20:63538201-63538223 GAAGGGGGCAGGGGTCCTGCGGG - Intergenic
1176611931 21:8991489-8991511 GATGGGTGGGGGTGAGCTGCTGG - Intergenic
1177565767 21:22818844-22818866 GAGGAGTGCGGGTGCACTGCGGG - Intergenic
1178630487 21:34255634-34255656 GATGTGTGCATGTGTGCTGTAGG - Intergenic
1179289683 21:40007660-40007682 GAGGGTTGTTGGCGTGCTGCAGG + Intergenic
1179437158 21:41369815-41369837 GCGGGGGGCAGGGGTGCGGCGGG - Intronic
1179489702 21:41733382-41733404 GAGGGGTGGAGGTGGGGTGCAGG + Intergenic
1179826055 21:43967121-43967143 CAGGCGTGCAGGTCTCCTGCCGG + Intronic
1179926985 21:44540157-44540179 GTGGGGAGGAGGTGAGCTGCGGG + Exonic
1180041063 21:45280398-45280420 GAGGGGTGCACGTGTTTTCCTGG + Intronic
1180202639 21:46234728-46234750 GAGGAGTGCAGGGGTGTAGCTGG - Intergenic
1181039147 22:20183819-20183841 GATGGGGGCATGTGTTCTGCCGG - Intergenic
1181528703 22:23503901-23503923 GGAGAGTCCAGGTGTGCTGCGGG - Intergenic
1181879413 22:25966130-25966152 GAGAGGAGCAGGTGTGCTTTTGG - Intronic
1181893330 22:26084212-26084234 GGGAGGTGCAGGTGTGCAGGGGG + Intergenic
1183075374 22:35423376-35423398 ACGGGGTGCAGGTCTTCTGCTGG + Intronic
1183353343 22:37345483-37345505 CAGGGGAGCAGGTGTGCCTCAGG - Intergenic
1183622994 22:38985743-38985765 GAGGAGTGCAGGGGTGGGGCAGG - Intronic
1183632999 22:39044872-39044894 GAGGAGTGCAGGGGTGGGGCAGG - Intronic
1184522362 22:45002660-45002682 TAGGAGTGCAGGGGTGCTGAGGG - Intronic
1184661061 22:45965724-45965746 CAGAGGTGCAGCTGTCCTGCGGG - Intronic
1185414373 22:50701702-50701724 GAGGGGTGCAGGTGTGGTTGGGG + Intergenic
949908389 3:8878762-8878784 TGGGGGTGCAGGTGAGCTGCTGG - Exonic
950446785 3:13043158-13043180 GAGGGGAGCGGCTGAGCTGCAGG + Intronic
950611779 3:14131664-14131686 GAGGAGTCCAGGTGAGCTGTTGG + Exonic
954743706 3:52774646-52774668 GGGGAGTGTAGCTGTGCTGCTGG - Intergenic
955216648 3:56989706-56989728 GAGTGGGGCAGGGGTGGTGCTGG - Intronic
955416172 3:58694074-58694096 GACGGATCCATGTGTGCTGCTGG + Intergenic
955768127 3:62366058-62366080 AAGGCGTCCAGGTGTGCTGGTGG - Intergenic
959905161 3:111703212-111703234 GAGGGATGCAGGGATGGTGCTGG + Intronic
961346840 3:126268570-126268592 AAAGGGTGCAGGTTTGCTGTGGG + Intergenic
961814621 3:129543122-129543144 GAGTGGTGGGGGTGGGCTGCTGG + Intergenic
962669427 3:137689981-137690003 GTGGGAAGCAGGTGTGCTGTGGG - Intergenic
963010940 3:140769772-140769794 GAGGAGTGCAGGGATGGTGCAGG - Intergenic
963742856 3:149097706-149097728 GAGGAGTGCAGGTGCACGGCAGG - Intergenic
963744219 3:149109731-149109753 GAGGAGTGCAGGTGCACAGCAGG + Intergenic
965803174 3:172515206-172515228 AAAGGATGCAGGTGTGCTTCAGG + Intronic
967816635 3:193804688-193804710 CATTGGTGCAGGTGGGCTGCAGG - Intergenic
968565032 4:1307627-1307649 CTGGGGTGCAGGTCTGCTGCGGG - Intronic
968583661 4:1406204-1406226 GTGGGGCGCAGGGGCGCTGCGGG + Exonic
968876370 4:3269834-3269856 GCGGGGAGCAGGTGGGCTGTTGG - Intronic
968960968 4:3743470-3743492 GTGGGGTGCGGGTGGGCTTCAGG + Intergenic
969716033 4:8868559-8868581 GCGGGGTGTTGGTGTGTTGCGGG - Intronic
970873392 4:20842344-20842366 GAGGGGTGCACTTCAGCTGCAGG + Intronic
971296748 4:25400605-25400627 CATGGCTGCAGGTCTGCTGCAGG + Intronic
972398200 4:38674974-38674996 CGGGGCTGCAGGTGAGCTGCAGG - Intronic
976194209 4:82517614-82517636 GAGGGGTGCAGGTATGTGTCTGG - Intronic
976286169 4:83373354-83373376 GAAGGGTGCATGCCTGCTGCTGG - Intergenic
983652563 4:170048298-170048320 GAGGAGTGCAGTTATGCAGCAGG - Intergenic
983989151 4:174097066-174097088 GGAGGGTGCAGGTGTGCTGTGGG + Intergenic
985424862 4:189820263-189820285 GAAGGATGCAGCTGAGCTGCTGG + Intergenic
985440350 4:189979372-189979394 CTGGGGTGCAGGGGGGCTGCCGG + Intergenic
986432490 5:7694888-7694910 GAGGGGTACACATGTGTTGCTGG - Intronic
988529187 5:32012281-32012303 AGGGGGTGCAGACGTGCTGCAGG - Intronic
993246405 5:85458743-85458765 GAGTGGGGCAGCTGTGCTGCAGG + Intergenic
993901083 5:93584683-93584705 GAGGGGAGCAGGGGTGTTGGGGG + Exonic
995253450 5:110019355-110019377 GGGTGGGGCAGCTGTGCTGCTGG - Intergenic
995271335 5:110222912-110222934 CATGGATGCAGGTGTGCTGGTGG + Intergenic
996372452 5:122767926-122767948 GAGGGGAGCAGGTGGGCAGTAGG + Intergenic
997285635 5:132676193-132676215 GAGGTGTGAAGATGTGCTGAAGG - Intronic
997392517 5:133528650-133528672 GAGTGGGGCAGGGGTTCTGCTGG - Intronic
997820462 5:137061551-137061573 GATGGGGGCAGGTTTGGTGCAGG - Intronic
998054841 5:139065658-139065680 GTGGGGTGGAGGTGTGAGGCAGG - Intronic
999817331 5:155190223-155190245 GAGAGGTGCATGTGTGCCTCAGG + Intergenic
1000019187 5:157304035-157304057 GAGGTGTGCAGGAGTACTGTGGG + Intronic
1000597687 5:163234718-163234740 GGGGGGTGGAGGGGGGCTGCGGG - Intergenic
1001238362 5:170049013-170049035 GAGGGGTGCAGGTTTCATGGAGG + Intronic
1001488976 5:172142144-172142166 GAGGTGTGCAGGTCTAATGCTGG - Intronic
1001562200 5:172677119-172677141 GAGGAATGCTGCTGTGCTGCTGG + Intronic
1001584013 5:172820510-172820532 AAAGGGTGCAGGTGGGCTCCGGG + Intergenic
1001981582 5:176041437-176041459 GTGGGGTCAAGGTGGGCTGCAGG + Intergenic
1002778018 6:344933-344955 GAGGGTTCCTGCTGTGCTGCTGG + Intronic
1003992210 6:11497431-11497453 AAGGGATGAAGGTGTGCTACTGG - Intergenic
1004441374 6:15658451-15658473 CAGGGGTGCAGGTGGGCGGCAGG + Intronic
1006294412 6:33163701-33163723 GAGGCGGGGAGGGGTGCTGCTGG - Exonic
1006630446 6:35426799-35426821 GTGGGGCTGAGGTGTGCTGCTGG - Exonic
1006644363 6:35505900-35505922 AAGGGGTGGAGGTGAGCTGCAGG + Intronic
1007166141 6:39830412-39830434 GAGGGAGGCAGGTGGGCTTCAGG + Intronic
1009685405 6:66949591-66949613 GAGGGGTGCAGGCCCACTGCTGG + Intergenic
1009766711 6:68086297-68086319 TAGGGGGGCATGTGTGTTGCGGG - Intergenic
1011744496 6:90396521-90396543 GAGGGGTGCTTGTGGGCTGGTGG + Intergenic
1013073469 6:106750310-106750332 GAGTGGTGCAGGGAGGCTGCTGG - Intergenic
1014140640 6:117938516-117938538 CAGGGGGGCAGGTGGGCTGGGGG - Intronic
1015354043 6:132255941-132255963 AAGGGGTGCAGGTGCGCAGAGGG - Intergenic
1016244378 6:141965383-141965405 GAGGTATGCAGGTGTGGAGCAGG - Intergenic
1018371844 6:163175634-163175656 GTCGGGAGCAGGTGAGCTGCAGG + Intronic
1019570254 7:1708092-1708114 GTGGGGTGCTGGTGGGGTGCAGG - Intronic
1019716339 7:2541158-2541180 GAGGGGTGCAGGGGCCGTGCAGG - Intronic
1019922971 7:4174522-4174544 ACAGGGTGCAGGTGTGCGGCAGG + Intronic
1020106145 7:5423244-5423266 GAGGGGTGGGGGTGGGCTGCTGG - Intronic
1020426281 7:8069509-8069531 GGGTGGGGCAGCTGTGCTGCTGG + Intronic
1020973525 7:14978175-14978197 GTGAGGTGGAGGGGTGCTGCTGG + Intergenic
1021817643 7:24463805-24463827 GAGGGGTGCAGCTCTGCTCTGGG - Intergenic
1022126358 7:27361299-27361321 AAGGTGTGCAGGTGTGGTGCTGG + Intergenic
1022822619 7:33975851-33975873 GTTGGGTGCATGTGTGCTGAGGG - Intronic
1023288296 7:38642739-38642761 CAGGGGTGCATGTGTGGGGCTGG - Intergenic
1023940603 7:44766427-44766449 GTGGGGTCCAGGTGACCTGCTGG - Exonic
1024505767 7:50159787-50159809 CAGGGGTGCATGTGGGCTGAGGG + Exonic
1024816525 7:53277566-53277588 GATGGGTCAAGGTGTGCTTCGGG - Intergenic
1025790350 7:64682258-64682280 GGGGAGTGCGGGTGTGCTGATGG - Intronic
1026438008 7:70416817-70416839 GAGGGGAGCAGGGGTGCAGGAGG - Intronic
1027297546 7:76793249-76793271 GAGGGGTGGAGGAGGGCTGAAGG - Intergenic
1029507721 7:100972379-100972401 GAGGGGTGGAGGAGCGCTGGTGG - Intronic
1029512980 7:101008408-101008430 GAGGGGGGCAGGTGAGCTAATGG - Intronic
1029670850 7:102029723-102029745 CTGGGATGCAGGTGTCCTGCTGG - Intronic
1031982441 7:128136407-128136429 GAGGGTGGGATGTGTGCTGCGGG - Intergenic
1033281524 7:140009704-140009726 GAGTGGGGCAGGTGTGGAGCGGG - Intronic
1033599176 7:142876699-142876721 GAGGGGAGCTGGGATGCTGCAGG - Intronic
1034422122 7:150995783-150995805 GAGGGGTGCAGGGGTGGGTCGGG - Intronic
1034422256 7:150996113-150996135 GAGGGGTGCAGGGGTGGGGTAGG - Intronic
1034422330 7:150996310-150996332 GAGGGGTGCAGGGGTGGAACAGG - Intronic
1035202402 7:157276079-157276101 GAGGGGGGCGAGGGTGCTGCAGG - Intergenic
1036692403 8:10952088-10952110 GAGAGGGGCAGGAGGGCTGCAGG - Intronic
1037672649 8:21028568-21028590 GAGGGGCGCAGCTGTGCTCACGG + Intergenic
1039410710 8:37352885-37352907 GAGGGATGCACCTGTTCTGCAGG + Intergenic
1039608410 8:38901153-38901175 GAGGGGTGCCGGGGCGCCGCGGG - Intergenic
1039677882 8:39690208-39690230 CATGGGTGTAGGTGTGCTGGTGG + Intronic
1043523351 8:81070540-81070562 GAGGTGTGCAGGTGCAGTGCTGG - Intronic
1045093842 8:98776324-98776346 CAGTGGTTCAGGTTTGCTGCAGG + Intronic
1047357608 8:124138587-124138609 GAGTGGTGCTGATGTGCTGGGGG - Intergenic
1048275935 8:133065941-133065963 GAGGGGTGCAGAAGTGCTGCTGG + Intronic
1049093840 8:140536197-140536219 GTGGGGTGGGGGTTTGCTGCTGG - Intronic
1049261032 8:141639324-141639346 GAGGGGTGCAGGGGGGAGGCTGG + Intergenic
1049583241 8:143422040-143422062 GACGGGAGCAAGGGTGCTGCAGG + Intronic
1049584144 8:143425223-143425245 GGGGGGTCCAGGTGGGCTGTCGG + Intronic
1049584154 8:143425264-143425286 GTGGGGTCCAGGTGGGCTGCGGG + Intronic
1049584162 8:143425304-143425326 GTGGGGTCCAGGTGGGCTGTCGG + Intronic
1049830772 8:144699632-144699654 GCGGGGTGCTGGTGGGCTACGGG + Intergenic
1050405394 9:5303994-5304016 GTGGGGTGCAGGAGTGCGCCCGG + Intronic
1050408696 9:5339160-5339182 GTGGGGTGCAGGAGTGCGCCCGG + Intronic
1053497908 9:38562097-38562119 GAGGGGTGGAAGTGTGTTGGGGG - Intronic
1055216800 9:73873285-73873307 GAGGGGTGCAGGTGTGCTGCAGG - Intergenic
1057200693 9:93138224-93138246 GAGGGGTCCAGCTGCACTGCGGG + Intergenic
1057455169 9:95202203-95202225 GAAGGCTCCAGGGGTGCTGCTGG + Intronic
1057795009 9:98149570-98149592 GGGGGGATCAGGTGTGCCGCAGG + Intronic
1060522023 9:124299326-124299348 GAGGGGTCTAGGGGTGCAGCTGG + Intronic
1060603422 9:124893587-124893609 GCGGGGTGCAGATGGGGTGCTGG + Intronic
1060996594 9:127877628-127877650 GAGGGGTGCGGGTGGGCGCCGGG + Exonic
1061113397 9:128591716-128591738 GAGGCGTGCAGGTGGGCTCCAGG - Intronic
1061255411 9:129452253-129452275 GGAGAGTCCAGGTGTGCTGCGGG + Intergenic
1061289885 9:129644666-129644688 GAGGGGTGGGGGTGGGCAGCTGG + Intergenic
1061368199 9:130183330-130183352 GAGGGGTGCAGGGCAGTTGCTGG + Intronic
1061503227 9:131015494-131015516 GAGGGGTGCAGGTGGAGTCCTGG - Intronic
1061781549 9:132999268-132999290 GGGGGCTGCAGGGATGCTGCGGG + Intergenic
1061865631 9:133490649-133490671 GAGGCGTGCAGGGGTGCTGTCGG + Intergenic
1061953651 9:133950289-133950311 GAGTGGAGCAGGTGGGCAGCTGG + Intronic
1062246045 9:135566687-135566709 CCGTGGTGCAGGTGTGCAGCAGG - Exonic
1062370364 9:136235690-136235712 GAGGGGAGCAGGTGGTCTTCAGG - Intronic
1062613702 9:137386812-137386834 GCAGGGAGCAGGTGTGCTGAGGG - Intronic
1062624385 9:137436303-137436325 CAGGGCCGCAGGTGTGCGGCTGG - Intronic
1203771239 EBV:51084-51106 GAGGGGGGCTGTTGTGGTGCTGG + Intergenic
1185831822 X:3310219-3310241 GAGGGGTGCAGGGGAGCTTCAGG + Exonic
1186899521 X:14038599-14038621 GAGGTGTGTATGTGTGCTACTGG - Intergenic
1187407379 X:19016038-19016060 GAGGGGTTCAGATGTACTGCTGG - Intronic
1188522902 X:31058553-31058575 CGTGGGTGCAGGTGTGCTGTAGG + Intergenic
1191589240 X:62862608-62862630 GAGGGATGCAGGTTTGATGTAGG - Intergenic
1192589868 X:72350921-72350943 GAGTGCTGCAGATGGGCTGCTGG - Intronic
1193425488 X:81337071-81337093 GAGTGGGGCAGCTGTGCTGCTGG + Intergenic
1196892863 X:120307857-120307879 GAGGGCTGCAGTAGTTCTGCAGG - Intronic
1199536155 X:148905576-148905598 GAGGAGTGCAGTTGAACTGCAGG - Intronic
1199622188 X:149711884-149711906 GAGGGGTGCAGATGTGGTCGAGG - Intronic
1199628993 X:149762989-149763011 GAGGGGTGCAGATGTGGTCGAGG + Intergenic
1199829784 X:151538156-151538178 GAGGGGAGCTGGGGAGCTGCCGG + Intergenic
1199899535 X:152159431-152159453 GATTGGTGGAGGTGTGCTGGAGG - Intergenic
1200163104 X:154019258-154019280 GGCGGGTGCAGGGATGCTGCTGG + Exonic
1201244182 Y:11986861-11986883 GAGGGGTGCAGGGGAGCTTCAGG - Intergenic