ID: 1055219387

View in Genome Browser
Species Human (GRCh38)
Location 9:73909963-73909985
Sequence GTGTCTCAGGGCTTAGATCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055219387_1055219392 24 Left 1055219387 9:73909963-73909985 CCAAGATCTAAGCCCTGAGACAC No data
Right 1055219392 9:73910010-73910032 GAAAAGCAAAGTGACTGAAAAGG No data
1055219387_1055219390 -4 Left 1055219387 9:73909963-73909985 CCAAGATCTAAGCCCTGAGACAC No data
Right 1055219390 9:73909982-73910004 ACACTCCAACATTAGATATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055219387 Original CRISPR GTGTCTCAGGGCTTAGATCT TGG (reversed) Intergenic
No off target data available for this crispr