ID: 1055219387 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 9:73909963-73909985 |
| Sequence | GTGTCTCAGGGCTTAGATCT TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1055219387_1055219392 | 24 | Left | 1055219387 | 9:73909963-73909985 | CCAAGATCTAAGCCCTGAGACAC | No data | ||
| Right | 1055219392 | 9:73910010-73910032 | GAAAAGCAAAGTGACTGAAAAGG | No data | ||||
| 1055219387_1055219390 | -4 | Left | 1055219387 | 9:73909963-73909985 | CCAAGATCTAAGCCCTGAGACAC | No data | ||
| Right | 1055219390 | 9:73909982-73910004 | ACACTCCAACATTAGATATCAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1055219387 | Original CRISPR | GTGTCTCAGGGCTTAGATCT TGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||