ID: 1055222915

View in Genome Browser
Species Human (GRCh38)
Location 9:73959594-73959616
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055222915_1055222920 24 Left 1055222915 9:73959594-73959616 CCAACCTAAGTTTGTTTTCTACT No data
Right 1055222920 9:73959641-73959663 CCTTTACCACTTCTGACCTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055222915 Original CRISPR AGTAGAAAACAAACTTAGGT TGG (reversed) Intergenic
No off target data available for this crispr