ID: 1055222920

View in Genome Browser
Species Human (GRCh38)
Location 9:73959641-73959663
Sequence CCTTTACCACTTCTGACCTT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055222914_1055222920 25 Left 1055222914 9:73959593-73959615 CCCAACCTAAGTTTGTTTTCTAC No data
Right 1055222920 9:73959641-73959663 CCTTTACCACTTCTGACCTTAGG No data
1055222916_1055222920 20 Left 1055222916 9:73959598-73959620 CCTAAGTTTGTTTTCTACTCTAG No data
Right 1055222920 9:73959641-73959663 CCTTTACCACTTCTGACCTTAGG No data
1055222915_1055222920 24 Left 1055222915 9:73959594-73959616 CCAACCTAAGTTTGTTTTCTACT No data
Right 1055222920 9:73959641-73959663 CCTTTACCACTTCTGACCTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055222920 Original CRISPR CCTTTACCACTTCTGACCTT AGG Intergenic
No off target data available for this crispr