ID: 1055223561

View in Genome Browser
Species Human (GRCh38)
Location 9:73967182-73967204
Sequence CCCATTTGGCACTATTATCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055223557_1055223561 -9 Left 1055223557 9:73967168-73967190 CCAGTACTGAGCTCCCCATTTGG No data
Right 1055223561 9:73967182-73967204 CCCATTTGGCACTATTATCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055223561 Original CRISPR CCCATTTGGCACTATTATCT AGG Intergenic
No off target data available for this crispr