ID: 1055225905

View in Genome Browser
Species Human (GRCh38)
Location 9:73994898-73994920
Sequence CCTTTTTTTTGGAGGGTGGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055225892_1055225905 7 Left 1055225892 9:73994868-73994890 CCGATATGTTTCTCTGTTCCTCC No data
Right 1055225905 9:73994898-73994920 CCTTTTTTTTGGAGGGTGGGGGG No data
1055225891_1055225905 28 Left 1055225891 9:73994847-73994869 CCATTGTGTATTTGCTATTGTCC No data
Right 1055225905 9:73994898-73994920 CCTTTTTTTTGGAGGGTGGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055225905 Original CRISPR CCTTTTTTTTGGAGGGTGGG GGG Intergenic
No off target data available for this crispr