ID: 1055229116

View in Genome Browser
Species Human (GRCh38)
Location 9:74040311-74040333
Sequence AACTTTTGACTACTGTTGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055229116_1055229119 1 Left 1055229116 9:74040311-74040333 CCAGTCAACAGTAGTCAAAAGTT No data
Right 1055229119 9:74040335-74040357 TACACAGATTTTCAACTGTGGGG No data
1055229116_1055229118 0 Left 1055229116 9:74040311-74040333 CCAGTCAACAGTAGTCAAAAGTT No data
Right 1055229118 9:74040334-74040356 ATACACAGATTTTCAACTGTGGG No data
1055229116_1055229120 2 Left 1055229116 9:74040311-74040333 CCAGTCAACAGTAGTCAAAAGTT No data
Right 1055229120 9:74040336-74040358 ACACAGATTTTCAACTGTGGGGG No data
1055229116_1055229117 -1 Left 1055229116 9:74040311-74040333 CCAGTCAACAGTAGTCAAAAGTT No data
Right 1055229117 9:74040333-74040355 TATACACAGATTTTCAACTGTGG 0: 3
1: 1
2: 2
3: 45
4: 260

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055229116 Original CRISPR AACTTTTGACTACTGTTGAC TGG (reversed) Intergenic
No off target data available for this crispr