ID: 1055232854

View in Genome Browser
Species Human (GRCh38)
Location 9:74086664-74086686
Sequence GCAAGTCCTGCTTTTCTAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055232845_1055232854 0 Left 1055232845 9:74086641-74086663 CCCCTTCTCTTTCACCCTTAGCG No data
Right 1055232854 9:74086664-74086686 GCAAGTCCTGCTTTTCTAGGGGG No data
1055232848_1055232854 -2 Left 1055232848 9:74086643-74086665 CCTTCTCTTTCACCCTTAGCGGC No data
Right 1055232854 9:74086664-74086686 GCAAGTCCTGCTTTTCTAGGGGG No data
1055232846_1055232854 -1 Left 1055232846 9:74086642-74086664 CCCTTCTCTTTCACCCTTAGCGG No data
Right 1055232854 9:74086664-74086686 GCAAGTCCTGCTTTTCTAGGGGG No data
1055232844_1055232854 6 Left 1055232844 9:74086635-74086657 CCTCAACCCCTTCTCTTTCACCC No data
Right 1055232854 9:74086664-74086686 GCAAGTCCTGCTTTTCTAGGGGG No data
1055232843_1055232854 7 Left 1055232843 9:74086634-74086656 CCCTCAACCCCTTCTCTTTCACC No data
Right 1055232854 9:74086664-74086686 GCAAGTCCTGCTTTTCTAGGGGG No data
1055232842_1055232854 8 Left 1055232842 9:74086633-74086655 CCCCTCAACCCCTTCTCTTTCAC No data
Right 1055232854 9:74086664-74086686 GCAAGTCCTGCTTTTCTAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055232854 Original CRISPR GCAAGTCCTGCTTTTCTAGG GGG Intergenic
No off target data available for this crispr