ID: 1055235576

View in Genome Browser
Species Human (GRCh38)
Location 9:74118786-74118808
Sequence TAGAGGAAAGGAAAGTAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055235567_1055235576 20 Left 1055235567 9:74118743-74118765 CCGTTTTTCACAAAAGGAAAAGG No data
Right 1055235576 9:74118786-74118808 TAGAGGAAAGGAAAGTAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055235576 Original CRISPR TAGAGGAAAGGAAAGTAGGA AGG Intergenic
No off target data available for this crispr