ID: 1055240831

View in Genome Browser
Species Human (GRCh38)
Location 9:74183700-74183722
Sequence AGTTCTCAGCAGAAGAGGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055240831_1055240837 12 Left 1055240831 9:74183700-74183722 CCTGCCCTCTTCTGCTGAGAACT No data
Right 1055240837 9:74183735-74183757 GTCCCTATCAGTATTATTCTTGG No data
1055240831_1055240838 13 Left 1055240831 9:74183700-74183722 CCTGCCCTCTTCTGCTGAGAACT No data
Right 1055240838 9:74183736-74183758 TCCCTATCAGTATTATTCTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055240831 Original CRISPR AGTTCTCAGCAGAAGAGGGC AGG (reversed) Intergenic
No off target data available for this crispr