ID: 1055240869

View in Genome Browser
Species Human (GRCh38)
Location 9:74184072-74184094
Sequence CGCTGCTGCCCTTGGAGTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055240869_1055240877 12 Left 1055240869 9:74184072-74184094 CCAGCACTCCAAGGGCAGCAGCG No data
Right 1055240877 9:74184107-74184129 TGCAGGGTGGGATCAGCAGCAGG No data
1055240869_1055240875 -1 Left 1055240869 9:74184072-74184094 CCAGCACTCCAAGGGCAGCAGCG No data
Right 1055240875 9:74184094-74184116 GGCAAAGGTGAACTGCAGGGTGG No data
1055240869_1055240878 13 Left 1055240869 9:74184072-74184094 CCAGCACTCCAAGGGCAGCAGCG No data
Right 1055240878 9:74184108-74184130 GCAGGGTGGGATCAGCAGCAGGG No data
1055240869_1055240876 0 Left 1055240869 9:74184072-74184094 CCAGCACTCCAAGGGCAGCAGCG No data
Right 1055240876 9:74184095-74184117 GCAAAGGTGAACTGCAGGGTGGG No data
1055240869_1055240874 -4 Left 1055240869 9:74184072-74184094 CCAGCACTCCAAGGGCAGCAGCG No data
Right 1055240874 9:74184091-74184113 AGCGGCAAAGGTGAACTGCAGGG No data
1055240869_1055240873 -5 Left 1055240869 9:74184072-74184094 CCAGCACTCCAAGGGCAGCAGCG No data
Right 1055240873 9:74184090-74184112 CAGCGGCAAAGGTGAACTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055240869 Original CRISPR CGCTGCTGCCCTTGGAGTGC TGG (reversed) Intergenic
No off target data available for this crispr