ID: 1055257251

View in Genome Browser
Species Human (GRCh38)
Location 9:74386121-74386143
Sequence CCTTTAGGCAGAAAATAGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055257251_1055257259 3 Left 1055257251 9:74386121-74386143 CCACCCTATTTTCTGCCTAAAGG No data
Right 1055257259 9:74386147-74386169 GATATAACTTCTTCTTTAGTGGG No data
1055257251_1055257262 29 Left 1055257251 9:74386121-74386143 CCACCCTATTTTCTGCCTAAAGG No data
Right 1055257262 9:74386173-74386195 GACACTAGACTCTTTACCCAGGG No data
1055257251_1055257261 28 Left 1055257251 9:74386121-74386143 CCACCCTATTTTCTGCCTAAAGG No data
Right 1055257261 9:74386172-74386194 TGACACTAGACTCTTTACCCAGG No data
1055257251_1055257260 4 Left 1055257251 9:74386121-74386143 CCACCCTATTTTCTGCCTAAAGG No data
Right 1055257260 9:74386148-74386170 ATATAACTTCTTCTTTAGTGGGG No data
1055257251_1055257258 2 Left 1055257251 9:74386121-74386143 CCACCCTATTTTCTGCCTAAAGG No data
Right 1055257258 9:74386146-74386168 GGATATAACTTCTTCTTTAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055257251 Original CRISPR CCTTTAGGCAGAAAATAGGG TGG (reversed) Intergenic
No off target data available for this crispr