ID: 1055257258

View in Genome Browser
Species Human (GRCh38)
Location 9:74386146-74386168
Sequence GGATATAACTTCTTCTTTAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055257251_1055257258 2 Left 1055257251 9:74386121-74386143 CCACCCTATTTTCTGCCTAAAGG No data
Right 1055257258 9:74386146-74386168 GGATATAACTTCTTCTTTAGTGG No data
1055257255_1055257258 -2 Left 1055257255 9:74386125-74386147 CCTATTTTCTGCCTAAAGGAGGG No data
Right 1055257258 9:74386146-74386168 GGATATAACTTCTTCTTTAGTGG No data
1055257253_1055257258 -1 Left 1055257253 9:74386124-74386146 CCCTATTTTCTGCCTAAAGGAGG No data
Right 1055257258 9:74386146-74386168 GGATATAACTTCTTCTTTAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055257258 Original CRISPR GGATATAACTTCTTCTTTAG TGG Intergenic
No off target data available for this crispr