ID: 1055259771

View in Genome Browser
Species Human (GRCh38)
Location 9:74419972-74419994
Sequence CAGTTTACTCATATGCAGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055259771_1055259776 30 Left 1055259771 9:74419972-74419994 CCATGCTGCATATGAGTAAACTG No data
Right 1055259776 9:74420025-74420047 TAAAGAGCTAGTATGTGGAAGGG No data
1055259771_1055259775 29 Left 1055259771 9:74419972-74419994 CCATGCTGCATATGAGTAAACTG No data
Right 1055259775 9:74420024-74420046 TTAAAGAGCTAGTATGTGGAAGG No data
1055259771_1055259774 25 Left 1055259771 9:74419972-74419994 CCATGCTGCATATGAGTAAACTG No data
Right 1055259774 9:74420020-74420042 GACATTAAAGAGCTAGTATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055259771 Original CRISPR CAGTTTACTCATATGCAGCA TGG (reversed) Intergenic
No off target data available for this crispr